Skip to main content


Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 2 Deoxyoligonucleotides used in this work

From: Complementation between inactive fragments of SssI DNA methyltransferase

Name Sequence Properties1 Use
AK183 GAGCTCTTCTTCACAAGAAGA M.SssI gene sense strand, positions 566-586. Starts with a SacI site Forward primer for [190-304]
AK184 GCTGCAGTTA AACATAACCTTCTGAATT M.SssI gene anti-sense strand, positions 912-895, stop codon and PstI site added Reverse primer for [1-304]
AK185 GCCATG GAATTTAAAAAAACAAAATCA M.SssI gene sense strand, positions 835-855, NcoI site added Forward primer for [279-386]
AK186 G CTGCAGTTAGCAGTGATGGTG M.SssI gene anti-sense strand, stop codon and PstI site added Reverse primer for His6-Cys-tagged C-terminal fragments
AK188 GCCATG GTTTATGATCCTGAATTTACA M.SssI gene sense strand, positions 910-930, NcoI site added Forward primer for [304-386]
AK189 GCCATG GAATTTGTTGAACTACCAAAG M.SssI gene sense strand, positions 721-741, NcoI site added Forward primer for [241-386]
AK258 GGCACGCTGACTAAAGGA TTTACCGCACTCGGG 6-ZFP-A gene antisense strand Mutagenic primer for elimination of a HindIII site
AK259 GCAGCTGTT TCTCCAAAGAAGAAGAGAAAAGT   Forward primer for amplification of the 6-ZFP-A gene
AK260 GCTGCAGTTA ACCCAGCTCGCCG   Reverse primer for amplification of the 6-ZFP-A gene
  1. Sequences are written in 5’ to 3’ direction. Sequences, which do not correspond to the template DNA, are underlined. 1Nucleotide positions are calculated relative to the first nucleotide of the ATG start codon of the WT M.SssI gene.