Skip to main content

Table 2 Sequences and related information of the primers

From: Selection of reference genes for gene expression studies in ultraviolet B-irradiated human skin fibroblasts using quantitative real-time PCR

Gene
symbol
Primer sequencea Amplicon length
(bp)
Annealing temperature
(°C)
PCR efficiencyb/E R
GAPDH F: ACAGTCAGCCGCATCTTCTT
R: GTTAAAAGCAGCCCTGGTGA
127 57 1.001 0.999
ACTB F: GGCGGCAACACCATGTACCCT
R: AGGGGCCGGACTCGTCATACT
205 62 1.06 0.95
TUBA1A F: GCAACAACCTCTCCTCTTCG
R: GAATCATCTCCTCCCCCAAT
200 57 1.043 0.991
TUBB1 F: CCTTGCAGCTGGAGAGAATC
R: CTGTCGGGTTGAAAGAGAGC
145 59 0.967 1.00
VIM F: GACAGGATGTTGACAATGCG
R: GTTCCTGAATCTGAGCCTGC
135 59 1.03 0.998
K10 F: GCCAACATCCTGCTTCAGAT
R: TCACATCACCAGTGGACACA
256 58   
  1. a All primer sequences are given in the 5'→3' direction.
  2. b PCR efficiencies were determined by PCR DataMiner and confirmed by a dilution series experiment.