Skip to main content

Table 1 Primer sequences, amplicon lengths and reaction efficiencies in RT-qPCR study.

From: Assessment and validation of a suite of reverse transcription-quantitative PCR reference genes for analyses of density-dependent behavioural plasticity in the Australian plague locust

Symbol Primer sequence (5'-3') size
(bp)
Tm
(°C)
Primer E
(error)
SD(E)
18SrRNA F: CTGAGAAACGGCTACCACATC
R: ACCAGACTTGCCCTCCAAT
171 84.9 0.25 1.91
(0.02)
0.02
Arm F: ACTTCTTATGAGAGCATTCCAGGAT
R: CCTTCAACAATTTCTTCCATGC
114 83.2 0.3 1.81
(0.03)
0.01
EF1a F: AGCCCAGGAGATGGGTAAAG
R: CTCTGTGGCCTGGAGCATC
155 81.4 0.3 1.99
(0.08)
0.04
RpL32 F: ACTGGAAGTCTTGATGATGCAG
R: CTGAGCCCGTTCTACAATAGC
97 78.6 0.25 1.97
(0.05)
0.04
GAPDH F: AATTGCCTGGCACCATTG
R: CGCCACAACTTTCCAGATG
128 80.7 0.3 1.95
(0.06)
0.00
Actin F: TTGTGTTGGATTCTGGTGATG
R: GAAGCTGTAGCCCCTCTCAG
149 83.5 0.5 1.66
(0.01)
0.02
SDHa F: CCACTGAAACTGATCCAAGAGAG
R: TCCTGCTCCATTAACTAAGCAAC
98 76.2 0.3 1.90
(0.05)
0.10
AnnIX F: GGAACTGATGAGGAAGCCATT
R: TGGCCTGAAGTGTCTCCTTT
134 77.2 0.5 1.91
(0.04)
0.05
  1. size: size of the cDNA amplicon; Tm: melt temperature of the PCR amplicon averaged over the 15 biological samples and 3 technical replicates; Primer: primer concentration in μM; E: in-run PCR reaction efficiency (fold increase per cycle) computed from the standard curve of a serial dilution included in the same plate as for samples S1 to S15 and using the formulae 10-(1/-slope of the standard curve); error: the mean square error of the standard curve; SD(E): standard deviation of the PCR efficiencies estimated from duplicated standard curves (different RT-qPCR runs and cDNA templates).