Skip to main content

Advertisement

Table 2 Oligonucleotides used for the mutations of Dlk2 GC-boxes

From: Characterization of a proximal Sp1 response element in the mouse Dlk2 gene promoter

PLASMID OLIGONUCLEOTIDES SEQUENCE
pGL3Basic(-212/+1M1) Sp1212/1M1F 5'- GTGCGCAGCGGGGGTGGATATAA GGCGCAGTCGGTGCGGG -3'
  Sp1212/1M1R 5'- CCCGCACCGACTGCGCCTTATAT CCACCCCCGCTGCGCAC -3'
pGL3Basic(-212/+1M2) Sp1212/1M2F 5'- GGGCGCAGTCGGTGCGGAATAA GCCGCGGCGGCGGGAGG -3'
  Sp1212/1M2R 5'- CCTCCCGCCGCCGCGGCTTATT CCGCACCGACTGCGCCC -3'
pGL3Basic(-212/+1M3) Sp1212/1M3F 5'- GGCTCCGCCGGCACACGTTATT CCTGGCAGGGGGCCGAG -3'
  Sp1212/1M3R 5'- CTCGGCCCCCTGCCAGGAATAA CGTGTGCCGGCGGAGCC -3'
pGL3Basic(+1/+177M4) Dlk2MluI-400U 5'- CCCGCGGCCAGCTAGGTTATTC CCCCCTCCCGCCCCC -3'
  Dlk2HindIII-1L 5'- GGGGGCGGGAGGGGGGAATAA CCTAGCTGGCCGCGGG -3'
pGL3Basic(+1/+177M5) Dlk2MluI-205U 5'- AGGGGCGGCCCCCCTCAATAA CCCGGCCCACGTCCGTC -3'
  Dlk2HindIII-1L 5'- GACGGACGTGGGCCGGGTTATT GAGGGGGGCCGCCCCT -3'
pGL3Basic(+1/+177M6) Dlk2 Xho-212U 5'-GCCCCCCTCCCGCCCCAATTAA CAGTCCGTCGGATCCG-3'
  Dlk2HindIII-1L 5'- CGGATCCGACGGACTGTTAATT GGGGCGGGAGGGGGGCC -3'