Skip to main content

Table 1 Key table for the primers used in DD-PCR study providing their names, origin and sequences.

From: Identification, phylogenetic analysis and expression profile of an anionic insect defensin gene, with antibacterial activity, from bacterial-challenged cotton leafworm, Spodoptera littoralis

Primer name Origin Sequence (5' -- 3')
CHIF Chitinase-based TGCCTTTGATTCAGTCATC
CHIR Chitinase-based AATAATCGACTCCAATACG
EGF Endoglucanase-based TCCGGGTATGTTATGGAAGA
EGR Endoglucanase-based GGCCATCCACTCTCAGACACA
LECF Lectin-based ATGGGATCCAAGCAACAGAG
LECR Lectin-based ATCCTTCAAAGACACAATGTCG
IDF Insect defensin-based CCAAATGCCTCGTCATCT
IDR Insect defensin-based ATTAGAGTCAAGCTAAAAGGG
HDF Human defensin-based TTATTTCTTTCTTCGGCAGC
HDR Human defensin-based GGAGCCCTTTCTGAATCCGCA
FLDefF Full length defensin GTTCGTCTATTTTTGTGCCG
FLDefR Full length defensin ACTTAAAAATCTATCATTGGCGTCA
MPDefF Mature peptide defensin GTTTCATGCGATTTCGAGGAAGCC
MPDefR Mature peptide defensin TCATGTGTAGGTATTTGTGTACC
PromF Random primer GGTCCCTGACTGATCCCTGG
PromR Flanking region of cDNA CTCATTATTTATATAACCTTAAC
  1. All oligonucleotides were synthesized by Invitrogen, USA and HPLC purified.