Skip to main content

Advertisement

Table 1 The oligonucleotides used for PCR primers

From: Cis-regulatory functions of overlapping HIF-1alpha/E-box/AP-1-like sequences of CD164

  Forward Reverse Restriction sites Amplified DNA Fragment Length (bps)
P1 5'-aagcgatcctcctgcctca-3' 5'-cgtgtcctcagcgctggcgttcg-3' KpnI XholI 1796
P2 5'-aagcgatcctcctgcctca-3' 5'-cgtgtcctcagcgctggcgttcg-3' SacI XholI 1453
P3 5'-agtagatggcgctcaccttta-3' 5'-cgtgtcctcagcgctggcgttcg-3' SacI XholI 1024
P4 5'-gcacagtcgctttgagggcc-3' 5'-cgtgtcctcagcgctggcgttcg-3' SacI XholI 258
P5 5'-taggattcccgttggtatcg-3' 5'-cgtgtcctcagcgctggcgttcg-3' SacI XholI 197
P6 5'-gaaaacaggggcctctcac-3' 5'-cgtgtcctcagcgctggcgttcg-3' SacI XholI 139
P7 5'-cgggggagcgtagtctcg-3' 5'-cgtgtcctcagcgctggcgttcg-3' SacI XholI 100
P8 5'-cgaaaacaggggcctc tcacgtgacccctgcgcgctccc gcgggggagcgtagtctcg-3' 5'-cgagactacgctccccc gcgggagcgcgcaggggtca cgtgagaggcccctgttttcg-3' SacI XholI 39