Skip to main content

Table 1 Primer sequences and amplicon characteristics of DCLs, XTH, and Gh-miR162

From: Profile of small interfering RNAs from cotton plants infected with the polerovirus Cotton leafroll dwarf virus

Gene Forward primer sequence (5'-3') Reverse primer sequence (5'-3') Amplicon size (bp) Efficiency ± SD* R2 Locus accession number
DCL1 AACCCTGGGTGGTGTCCCCTG ATGCCCCCTTTTGGCTGGCTC 132 0.928647 ± 0.0293724 0.9858 ES804646.1
DCL2 GATCGCTATCATGCTTCTCCGCAG TGGGGAACCAAGAAGACAGCGAA 81 0.99522 ± 0.00361129 0.9903 DW488144
DCL3 ATGTCCACATGCCCCCTGAGCT GGCCAACATTAAGGACTCCAGCCG 113 0.997162 ± 0.0071986 0.9646 DR462994
DCL4 GCTTCCAAGCGGCAACAGCATT AGGATGCACAATCGCCTGAAGGAG 186 0.992603 ± 0.0051324 0.9706 DT568872
Gh-miR162 GCGGCGGAGCTATTTGGAGACG GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACCTGGAT 72 0.884982 ± 0.032819 0.8519 -
XTH GGAAAGGGTGACAGGGAACA GGCTGGAGTTTTGGGTATGG 173 and 392** - - AY189971.2
  1. *Efficiency ± standard deviation (SD) generated by the Miners software. ** in DNA sample.