Skip to main content

Table 2 Sequences of platypus XNDR-TRPC 2-specific primers

From: Identification of two distinct genes at the vertebrate TRPC2 locus and their characterisation in a marsupial and a monotreme

Gene name sequence location of primer binding
XNDR p1F GCAGAGGACGGAGAGATGGGTCAAG Exon 9
  p1R CGAGGAGGGGCAGGAGTGGAAAC Exon β
TRPC2 p2F GGAGACGGCACAGGGAACGG Exon 10
  p2R TTGAGCACGGCGGTCACCTC Exon 13