Skip to main content

Table 1 Sequences of tammar-specific primers

From: Identification of two distinct genes at the vertebrate TRPC2 locus and their characterisation in a marsupial and a monotreme

gene name sequence location of primer binding
XNDR- 1F GGCTTATGGCTGCTCTCTTTCTGTGAC Exon 2
TRPC2 2F TCCTCATGGCTCCTGTGAAGATCAG Exon 2
  3F CGGAGAACATTCTTCCCAGA Exon 6
  4F TTCCCTCTCCCGAATTAACA Exon 12
  5F AGCAAACAGAGCAAGACTAGGAGGGTATAG Exon β
  1R TTCTTCCTGAAACCCCCTGTGAATC Exon 23
  2R TGAATCTCCACTTGGGCAGCGG Exon 23
  3R ATAGGTGGCACGGGGTTAGGTCAG Exon 23
  4R ACATCTGAGCTGGCTGTGTG Exon 7
  5R GCCAAGTTTCCACACCAGAT Exon 14
  6R TTGGGTTGGGGCTGGAATAGTAATG Exon 11
CNGA2 for TGTGCTTGATCCTGCTGGAGACTG  
  rev ACCACATCAGTGGGGATGACGG  
SOX2 for TGGAGCAACGGCGGCTACGG  
  rev CCTGGAGTGCGACGACGAGG  
GAPDH for CCTACTCCCAATGTATCTGTTGTGG  
  rev GGTGGAACTCCTTTTTTGACTGG