Skip to main content

Table 3 PCR primers used to prepare pGL4-FABP7 promoter constructs

From: Analysis of the regulation of fatty acid binding protein 7 expression in human renal carcinoma cell lines

Position, cloning site and orientation Sequence
-1122 Bgl II Sense CTTTCAGATCTGGTCAGCACTAGTAAG
-468 Bgl II Sense CACTAAGATCTCTCCTTTGTCTGCAAAG
-351 Bgl II Sense ATCTTAGATCTTTTCCTTGCAGTCTGAG
-192 Bgl II Sense GAACTAGATCTACTCCGCTAACCCAG
-149 Bgl II Sense CAAAGAGATCTGGAGCCTCACTCGAGC
-83 Bgl II Sense AGAGGAGATCTGGAGGGGTGTGTTTG
-72 Bgl II Sense GAGAGATCTGTTTGCAATTTAAATCACTGG
-61 Bgl II Sense TTTGAGATCTAAATCACTGGATTTTTGCCC
-48 Bgl II Sense TCACAGATCTTTTGCCCACCCTCTTTCC
-36 Bgl II Sense CCCAAGATCTTTCCAAATAAGAAGGCAG
+89 Hin dIII Antisense ACAGAAAGCTTCCACCATCCTTGCCC