Skip to main content

Table 2 RT-PCR and Q-PCR primers

From: Analysis of the regulation of fatty acid binding protein 7 expression in human renal carcinoma cell lines

cDNA Sequence Annealing temperature (°C) Number of cycles
FABP7 TGACCAACAGTCAGAACTTT 54 40
  GCCATCCCATTTCTGTATGTG   
TBP TTCGGAGAGTTCTGGGATTGTA 58 40
  TGGACTGTTCTTCACTCTTGGC   
BRN2 CGGCGGATCAAACTGGGATTT 57 40
  TTGCGCTGCGATCTTGTCTAT   
OCT1 GCATCCAACCACCAATTTGC 57 30
  GAGGTGAGGGTGATGCTTG   
OCT6 GCGGCGCATCAAGCTGGG 63 38
  CGGTTGCAGAACCAGACGCG   
NFIA CAGCCAAGTGACGCTGACA 60 25
  CCTCATTGCTCCTGGACTCAT   
NFIB (1) CATAACCCAGGGAACTGGAG 60 25
  CTCTTTCGTGCCATGTTCGAC   
NFIB (2) CTCCCATCTGTCTCACTCAGG 58 25
  CACGGGTGCTTCTTGCCAGTC   
NFIC GGACAGGGATGGGCTCTG 58 35
  CGTTCTTCTGAGGCCAGTGC   
NFIX GTTTTGTGACTTCCGGGGTCTG 58 35
  GGAAGGAGGGGAGGTGATG   
β-actin CAAACATGATCTGGGTCATCTTCTC 60 25
  GCTCGTCGTCGACAACGGCTC