Skip to main content

Table 1 Gel shift probes

From: Analysis of the regulation of fatty acid binding protein 7 expression in human renal carcinoma cell lines

Name Sequence Sense or Antisense
Upstream probe TGTGTTTGCAATTTAAATCACTGGA
  TCCAGTGATTTAAATTGCAAACACA
Middle probe TAAATCACTGGATTTTTGCCCAC
  GTGGGCAAAAATCCAGTGATTTA
Downstream probe TTTTTGCCCACCCTCTTTCCAAA
  TTTGGAAAGAGGGTGGGCAAAAA
C/EBP alpha TCTTTGGAAAGGT
  ACCTTTCCAAAGA
OCT1 GTAAATGCAAATCAG
  CTGATTTGCATTTAC
BRN2 GCCATTCGAAATGAGC
  GCTCATTTCGAATGGC
OCT6 GAGGAATTAGACTGC
  GCAGTCTAATTCCTC
NFI TCTTGGCAAGAAGCCAAG
  CTTGGCTTCTTGCCAAGA
C/EBP beta AGCTTGCACAACTC
  GAGTTGTGCAAGCT
YY1 GATAACCATTTTTGAAC
  GTTCAAAAATGGTTATC
SP1 TGAGGCAGGGT
  ACCCTGCCTCA