Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 The primers used in this study

From: GhMPK16, a novel stress-responsive group D MAPK gene from cotton, is involved in disease resistance and drought sensitivity

Abbreviation Sequence (5'--3') Description
MP1 AARGGNAGYTAYGGNGTNGT Degenerate primer, forward
MP2 GCNACRTARTCNGTCCARAA(H = A, C, or T; N = A, C, G, or T; R = A or G; V = A, C, or G; Y = C or T) Degenerate primer, reverse
3P1 TTCTTTATCAGCTTCTTCGGG 3' RACE reverse primer, outer
3P2 TTCATCGGGATCTAAAGCCG 3' RACE reverse primer, nested
B26 GACTCGAGTCGACATCGAT (T)18 Universal primer, outer
B25 GACTCGAGTCGACATCGAT Universal primer, nested
5P1 GAAGGAGGGAACAATATGTGC 5' RACE reverse primer, outer
5P2 ATGACGTAGGAGCCTGAGAAG 5' RACE reverse primer, nested
AAP GGCCACGCGTCGACTAGTAC (G)14 Abridged anchor primer
AUAP GGCCACGCGTCGACTAGTAC Abridged universal amplification primer
Z1 CCGCACTTGGATACATGAAGCC Genomic sequence primer
Z2 GAGTATCTGGAAGGATCAGAGCC Genomic sequence primer
5P3 GCTGCCAGACCTGGGAAAGTAG primer used for probe synthesized