Skip to main content

Advertisement

Table 1 The primers used in this study

From: GhMPK16, a novel stress-responsive group D MAPK gene from cotton, is involved in disease resistance and drought sensitivity

Abbreviation Sequence (5'--3') Description
MP1 AARGGNAGYTAYGGNGTNGT Degenerate primer, forward
MP2 GCNACRTARTCNGTCCARAA(H = A, C, or T; N = A, C, G, or T; R = A or G; V = A, C, or G; Y = C or T) Degenerate primer, reverse
3P1 TTCTTTATCAGCTTCTTCGGG 3' RACE reverse primer, outer
3P2 TTCATCGGGATCTAAAGCCG 3' RACE reverse primer, nested
B26 GACTCGAGTCGACATCGAT (T)18 Universal primer, outer
B25 GACTCGAGTCGACATCGAT Universal primer, nested
5P1 GAAGGAGGGAACAATATGTGC 5' RACE reverse primer, outer
5P2 ATGACGTAGGAGCCTGAGAAG 5' RACE reverse primer, nested
AAP GGCCACGCGTCGACTAGTAC (G)14 Abridged anchor primer
AUAP GGCCACGCGTCGACTAGTAC Abridged universal amplification primer
FL1 GATGCTAAGATGCAGCCTGATC Full-length cDNA primer
FL2 GCTTCACTTGTAACTTGTCTGAGC Full-length cDNA primer
Z1 CCGCACTTGGATACATGAAGCC Genomic sequence primer
Z2 GAGTATCTGGAAGGATCAGAGCC Genomic sequence primer
5P3 GCTGCCAGACCTGGGAAAGTAG primer used for probe synthesized
Wup1 CACGCCATTAAACCAAGTAG I-PCR primer
Wdra1 GAGGTTGACTAACACTAGTG I-PCR primer
Wup2 GATCAGGCTGCATCTTAGCATC I-PCR primer
Wdra2 AGCGTATGACACGCATACTG I-PCR primer
Wbd-1 GCGC TCTAGA GGGGCTTCCTGTTTGATGCC Xba I Coding region primer
Wbd-2 GCGC GTCGAC CCTCAACCAGCAGTAGGAAG Sal I Coding region primer
W-GFP GCGC CTCGAG ATACCACTGACTTGATCCAG Xho I Coding region primer
AtEF-1α-F ATGGGTAAAGAGAAGTTTCACAT RT-PCR primer
AtEF-1α-R CTTGTTACAACAGCAGATCAT RT-PCR primer
AtPR1-F GACGAGAGGGTTGCAGCCTATG RT-PCR primer
AtPR1-R GATTCTCGTAATCTCAGCTCT RT-PCR primer
AtPR4-F CCACCTACCATTTCTATAATCC RT-PCR primer
AtPR4-R CACAGTCGAGAAATTGGTAGTC RT-PCR primer
AtPDF1.2-F TCATGGCTAAGTTTGCTTCC RT-PCR primer
AtPDF1.2-R AATACACACGATTTAGCACC RT-PCR primer