Skip to main content

Table 1 PCR primers used in the analysis of Smtnl1.

From: Mapping and functional characterization of the murine Smoothelin-like 1 promoter

RT-PCR & nested PCR  
mSmtnl1-F1 AAGAAGGATCGAGCACCAGAAC
mSmtnl1-R1 ACACACTTGGAATCGGGCAC
mSmtnl1-nested-F1 GGAAGGCCATCATGGACAAATTT
mSmtnl1-nested-R1 GCACAGTCGGCTAGTTTCTCTG
5'-RACE  
5'-CDS dT25VN (N = A, C, G, or T; V = A, G, or C)
SMART II A AAGCAGTGGTATCAACGCAGAGTACGCGGG
UPM 5:1 mixture of (1): (2)
(1) CTAATACGACTCACTATAGCAAGCAGTGGTATCAACGCAGAGT
(2) CTAATACGACTCACTATAGC
NUPM AAGCAGTGGTATCAACGCAGAGT
GSP1 CCACCTCCAGCAGCTGGGCACAGTCGGCTAG
GSP2 GCCTCGTTCTAGCCGAGCTGCCTCACTCTCCAT
GSP3 CACCCCACCTTCAAGAGGCCCGGGCTTCG
NGSP1 CACCCCACCTTCAAGAGGC
NGSP2 CCAACTCCTTTGTGTCACTTCCG
RPA  
RPA2 TAATACGACTCACTATAGGGCTGATCAGATGCTAGGTACACTT
GCTTCCACCACCCCTTGCTTCCACC
T7 promoter TAATACGACTCACTATAGGG
RPA-NCS GAGAGGGACGCAGCAGCGTG
RPA-NCA GGTTCTGCCTGCAGCTCGG
RPA-M1-2S TAGAACGAGGCAAGAGCTCC
RPA-M1-2A GTTCTGCCCAATCTGAAGGC
RPA-FR1 GCCACCTGTCAGATCTTCGG
RPA-RT7 TAATACGACTCACTATAGGGCTGATCAGATGCTAGGTACAG
TTCTGCCCAATCTGAAG
Promoter Truncations  
+100 bp LUC R1 GTGGGATCCGTGAAAGGTAAGAATAGG
0 bp LUC F1 CTAGCCTTCTAGAACGAGGCAAGAGCTCC
-118 bp LUC F2 CTAGAATTCCTTCCCGAAGCCCGGGC
-218 bp LUC F3 CTCGAATTCGCAGCGTGATTGAAAGATG
-468 bp LUC F4 CTAGAATTCCCCCTCAGCAGCTACTTTG
-767 bp LUC F5 CTCGAATTCCGTTGGGAACTGGGAATTCCG
-1350 bp LUC F6 CTAGAATTCGACAAAGCTTGGGGTCTATATC
-1637 bp LUC F7 CTAGAATTCCTCTTAACCTCCAAGACATC
-1869 bp LUC F8 CTAGAATTCCTCTTAACCTCCAAGACATC
-2368 bp LUC F9 CTAGAATTCCAAAGTCCTATTGCTTGCACC
-2759 bp LUC F10 GCTGAATTCGAATTATCTCATGGACTTGCCTAGAG