Skip to main content

Advertisement

Table 2 PCR primers used in this study.

From: Selection of reliable reference genes during THP-1 monocyte differentiation into macrophages

mRNA mRNA name GenBank accession no. Forward primer1 Reverse primer1 Amplicon Size [bp] PCR efficiency [%]
ABL1 c-abl oncogene 1 NM_005157.3, NM_007313.2 GAGCACAGAGACACCACTGACG GCTCATCTTCATTCAGGCCG 148 100.9
ACTB β-actin NM_001101.3 ATTGCCGACAGGATGCAGAA GCTGATCCACATCTGCTGGAA 150 97.9
B2M β-2-microglobulin NM_004048.2 GCTCCGTGGCCTTAGCTGT ACGTGAGTAAACCTGAATCTTTGGA 89 101.1
CD36 CD36 NM_001001548.2, NM_001001547.2, NM_000072.3, NM_001127443.1, NM_001127444.1 TCACTGCGACATGATTAATGGTACA ACGTCGGATTCAAATACAGCATAGAT 126 99.2
EIF2B2 Eukaryotic translation initiation factor 2B2 NM_014239.2 TCCACCCCACTCATCGTCTG TGGCAGGACTTCTTCAGGAGC 105 101.1
G6PD Glucose-6-phosphate dehydrogenase NM_000402.3, NM_001042351.1 CCGTCACCAAGAACATTCACG GGACAGCCGGTCAGAGCTCT 107 98.7
GAPDH Glyceraldehyde-3-phosphate dehydrogenase NM_002046.3 CAACAGCGACACCCACTCCT CACCCTGTTGCTGTAGCCAAA 115 101.7
GUSB β-glucuronidase NM_000181.3 AGCTCATTTGGAATTTTGCCG GAGTGAAGATCCCCTTTTTATTCCC 81 101.8
H3F3A H3 histone, family 3A NM_002107.3 TGGCGCTCCGTGAAATTAGA TGAGCAATTTCTCGCACCAGA 91 97.0
POLR2K Polymerase (RNA) II (DNA-directed) polypeptide K NM_005034.3 ACCCAGAAGGACGTTCAACCTC TCTCTGCATCTGATTGGATCCC 107 98.9
PPARA Peroxisome proliferator-activated receptor α NM_001001928.2, NM_005036.4 AGCCCCTCCTCGGTGACTTAT GCTTGAGTCGAATCGTTCGC 172 94.6
PPARD Peroxisome proliferator-activated receptor δ NM_006238.3, NM_177435.2 AGAACCGCAACAAGTGCCAG GCATCCGACCAAAACGGA 87 99.1
PPARG Peroxisome proliferator-activated receptor γ NM_138712.3, NM_015869.4, NM_138711.3, NM_005037.5 TTCAGAAATGCCTTGCAGTGG AGCTTCTCCTTCTCGGCCTG 79 100.6
PPIB Peptidylprolyl isomerase B (cyclophilin B) NM_000942.4 ATGGCAAGCATGTGGTGTTTG CCCGGCTGTCTGTCTTGGT 84 96.8
PSMB2 Proteasome subunit, β type 2 NM_002794.3 ACGGCAGCAGCTAACTTCACA TGGCCCTTCATGCTCATCA 108 101.9
PSMB6 Proteasome subunit, β type 6 NM_002798.1 GGAATCATCATCGCAGGCTG CTGCCTTACCATCATACCCCC 81 101.6
QARS Glutaminyl-tRNA synthetase NM_005051.1 GAGCGTCTTGGATATTTCTCCGT GCTTCCAGCTCACACCTTTCC 108 98.3
RPL37A Ribosomal protein L37a NM_000998.4 ATTGAAATCAGCCAGCACGC AGGAACCACAGTGCCAGATCC 94 97.6
SRP14 Signal recognition particle 14 kDa NM_003134.4 AGCACTGTGGTGAGCTCCAAG TCAGCCCATCCATGTTAGCTCTA 82 95.1
TUBA1 α1-tubulin NM_006009.2, NM_006082.2, NM_032704.3 GCACTACACCATTGGCAAGGA AACCAGTTCCCCCACCAAAG 122 98.4
TXNRD1 Thioredoxin reductase 1 NM_003330.2, NM_182742.1, NM_182729.1, NM_182743.1, NM_001093771.1 CACAATTGGAATCCACCCTGTC GCTTGCCCCAGAGCGC 73 99.2
UBE2D2 Ubiquitin-conjugating enzyme E2D 2 NM_003339.2 CCAGATGATCCTTTAGTGCCTGAG ACATCGCATACTTCTGAGTCCATTC 100 102.5
  1. 1In each case, forward and reverse primers are located in different exons.