Skip to main content

Advertisement

Table 1 siRNA and shRNA sequences and their reporter targets used in this study

From: A direct comparison of strategies for combinatorial RNA interference

siRNA shRNA Sequence (5'-3') Reporter Target gene (Ref)
si-1a sh-1a GCACAUUUGUCGAGCUUAA psi-CHK-1 MDV gB [31]
si-1b sh-1b GGUUGGACAUGUACAAUAU psi-CHK-1 MDV gB [31]
si-2 sh-2 GAGUUAUGCUGAUAUGAAU psi-CHK-2 MDV UL29 [31]
si-3 sh-3 GGAGUUCACUGUAUCGUAC psi-CHK-3 MDV ncRNA (unpublished data)
- sh-4 GCUGGACUCCUUCAUCAAC psi-CHK-4 Renilla luciferase (unpublished data)
- sh-5 CAGCCAAUCACAUCCAUCAAA psi-CHK-5 IBDV VP2 [47]
si-NS sh-NS UUCUCCGAACGUGUCACGU - -