Skip to main content

Table 1 Details of the primer pairs used for real-time PCR.

From: Evaluation of endogenous references for gene expression profiling in different tissues of the oriental fruit fly Bactrocera dorsalis (Diptera: Tephritidae)

Gene name GenBank accession number Primer sequences (forward/reverse) Amplicon length (bp) Efficiency (%) R 2
GAPDH GU269901 GACGCCTACAAGCCTGACAT GTTGAAGCGGGAATGATGTT 221 103.2 0.996
G6PDH AB021910 CCTACAAACTTCTGCGGTTATGC AGAGCGAGGCGAGGTGATC 382 87.2 0.998
EF1α GU269900 CGTTGGTGTCAACAAGATGG TGCCTTCAGCATTACCTTCC 230 107.6 0.957
18S AF033944 GCGAGAGGTGAAATTCTTGG CGGGTAAGCGACTGAGAGAG 191 100.3 0.999
α-TUB GU269902 CGCATTCATGGTTGATAACG GGGCACCAAGTTAGTCTGGA 184 104.8 0.994
β-TUB EU938673 TTACATTTCTTTATGCCTGGTTTC CATTTGTTCGTCCACTTCCTTC 204 104.0 0.985
ACT1 L12253 AGCGTGAAATCGTGAGGGA GACAAGACCGAGTTGGCATA 286 98.2 0.999
ACT2 L12254 GTGTGATGGTTGGTATGGGA GGCTGGGGAGTTGAAGGTTT 269 89.5 0.998
ACT3 L12255 GGTCGGTATGGGACAGAAGG CTCACGATTGGCTTTTGGAT 220 94.5 0.996
ACT5 L12256 CAACTCACCCGCAATGTATG CGCTCAGCAGTGGTTGTAAA 237 100.6 0.996
  1. R2, coefficient of determination.