Skip to main content

Table 2 Primer sequences, exon location (where possible), efficiency and amplicon length for candidate reference genes and the test circadian gene.

From: Determination of reference genes for circadian studies in different tissues and mouse strains

Symbol Primer Sequence Amplicon length Primer location1 [exon] Primer efficiency
Reference genes     
Rplp0 fw CACTGGTCTAGGACCCGAGAAG 73 4 1.98
  rv GGTGCCTCTGGAGATTTTCG   4  
Ppib fw GGAGATGGCACAGGAGGAAA 73 3 1.93
  rv CCGTAGTGCTTCAGTTTGAAGTTCT   4  
Gapdh fw CCAATGTGTCCGTCGTGGATCT 239 5 1.94
  rv GTTGAAGTCGCAGGAGACAACC   6  
Actb fw CTTCCTCCCTGGAGAAGAGC 124 4 1.98
  rv ATGCCACAGGATTCCATACC   5  
Hmbs fw TCCCTGAAGGATGTGCCTA 73 7 1.64
  rv AAGGGTTTTCCCGTTTGC   8  
Hprt1 fw TCCTCCTCAGACCGCTTTT 90 1 1.89
  rv CCTGGTTCATCATCGCTAATC   2  
Rn18s fw CGCCGCTAGAGGTGAAATTC 62 n.a. 1.79
  rv TTGGCAAATGCTTTCGCTC   n.a.  
Eif2a fw CAACGTGGCAGCCTTACA 74 2 1.95
  rv TTTCATGTCATAAAGTTGTAGGTTAGG   3  
Utp6c fw TTTCGGTTGAGTTTTTCAGGA 75 17 1.82
  rv CCCTCAGGTTTACCATCTTGC   18  
Tbcc fw GACTCCTTCCTGAACCTCTGG 62 n.a. 1.90
  rv GGAGGCCATTCAAAACTTCA   n.a.  
Circadian gene     
Dbp fw AATGACCTTTGAACCTGATCCCGCT 175 7 1.93
  rv GCTCCAGTACTTCTCATCCTTCTGT   7