Skip to main content

Table 3 Twelve different spliced leader sequences in A. avenae mRNAs.

From: Expression profiling and cross-species RNA interference (RNAi) of desiccation-induced transcripts in the anhydrobiotic nematode Aphelenchus avenae

SL name SL sequence EST accession no.
SL1a GGTTTATATACCCAAGTTTGAG EF026240, GR463910, GR463914, GR463901
SL1b GGTTTTATTACCCAAGTTTGAG GR463903
SL1c GGTTTAAATACCCAAATTTGAG EF026241, GR463900
SL1d GGTTTAAATACCCTAATTTGAG GR463894
Variant 1 GGTTTAAATACCCTTTATTGAG GR463919
Variant 2 GGTTTATACACCCAAGTTTGAG GR463909
Variant 3 GGTTTTATTACCCCAGTTTGAG GR463912
Variant 4 GGTTTAAATACCCGAATTTGAG EF026246
Variant 5 GGTTTACACCCAGTATCACAAG GR463907
Variant 6 GGTTTAATACCCAGTATCACAAG GR463905, GR463906
Variant 7 GGTTTAAAACCCAGTATCACAAG GR463915
Variant 8 -GTTTTTACAGAAAACCACAAG GR463918
SL1 [C. elegans] GGTTTAATTACCCAAGTTTGAG  
SL2 [C. elegans] GGTTTTAACCCAGTTACTCAAG  
  1. SL1a to SL1d are described in ref. [13]. The two canonical spliced leader sequences from C. elegans are listed for comparison. In cases where A. avenae ESTs are not listed, the respective cDNAs are incomplete at the 5' end and cannot be assessed for spliced leader use.