Skip to main content

Table 2 Primer sequences of GAPDH

From: Effect of experimental treatment on GAPDH mRNA expression as a housekeeping gene in human diploid fibroblasts

Gene Sequence (5'-3') Size of PCR product
GAPDH (Forward) TCCCTGAGCTGAACGGGAAG 217
GAPDH (Reverse) GGAGGAGTGGGTGTCGCTGT