Skip to main content

Table 1 Comprehensive list of oligonucleotide primers used for RACE and quantitative PCR

From: Characterisation of the sarcomeric myosin heavy chain multigene family in the laboratory guinea pig

Primer Name Forward (5' - 3') Reverse (5' - 3') Tm (°C) Expected Product (bp)
GP_626 bp TGTCATCCAGTACTTTGCAACAA TGAGCAGGTCAGCAGAGTTC 60 626
Reverse_GSP_2 - CAGGCTGCGTAACGCTCTTTGAGGTTGT 68 -
Reverse_Nested_GSP_2 - CTCGTGCAGGTGGGTCATCATGG 68 -
Forward_GSP_2 CATGATGGCCGAGGAGCTGAAGAAG - 68 -
Forward_Nested_GSP_2 AAGGGCGGCAAGAAGCAGATCCAGAAG - 68 -
MyH7Term3' AAGTATCGCAAGGCTCAA CCTTTCCTTAATTCCAAGC 55 129
MyH13'UTR TTCATCCAAATGCAGGAAAG TCTTTATCTCAAAAGTCATAAATACAA 55 90
MyH23'UTR TGTGGAATGACCAGAGCAAG CCTTTGCAATAGGGTAGGACA 55 85
MyH43'UTR TCCATCTACTGCTGCAACG ACTCTGCAGATTTTATTTCCTTG 55 93