Predator-induced defences in Daphnia pulex: Selection and evaluation of internal reference genes for gene expression studies with real-time PCR

Table 1 Candidate reference and differentially expressed genes with putative function and gene ID from the Dappu V1.1 draft genome annotation, primer sequences, amplicon characteristics.

Gene symbol	Gene name	(putative) Function	Gene ID	P	Primer sequences [5'→3']	L (bp)	Localization in gene	E (%)
aTub	alpha Tubulin	Cytoskeletal protein	Dappu-301837	5	GCATGTTGTCCAACACTACTGC	135	3' exon	91
					CCTCAGAGAACTCTCCCTCCTC
GAPDH	Glyceraldehyde-3-phosphate dehydrogenase	Glycolytic enzyme	Dappu-302823	0	TGGGATGAGTCACTGGCATAC	136	3' exon	93
					GAAAGGACGACCAACAACAAAC
Tbp	TATA binding protein	Transcription initiation	Dappu-194512	0	CTACGATGCATTCGATAACATATACC	144	3' exon	90
					AGAACCAGCAATGAGTTAAACAAAG
Stx16	Syntaxin 16	Protein involved in exocytosis	Dappu-194044	0	CACATTGGTCGTCCTTAGTCTTG	148	3' exon	93
					TGCTATACGTTACGCTTGTCCTTAC
Xbp1	X-box binding protein 1	Transcription factor	Dappu-314438	0	CCGATATTCGAGACTGCAATG	131	3' exon	93
					AAAGATGGGTGAGCCAGAAATAC
MMP	Matrix metallo-proteinase	Degradation of extracellular proteins	Dappu-303491	0	CGAAACATGGACGCATAACTC	80	spanning penultimate 3' intron	92
					GTCCCAAAGTGTGACCGAAC
CAPON	C-terminal pdz ligand of neuronal nitric oxide synthase	Location of neuronal nitric oxide synthase	Dappu-100564	0	TAACGAGTCGGGAGGAAGTG	140	3' exon	94
					GCTGGACTTGAGCCAGTATCTC

Abbreviations: E: amplification efficiency; P: number of paralogs in D. pulex genome; L: length of the amplicon

ISSN: 1471-2199