Skip to main content

Advertisement

Table 1 Candidate reference and differentially expressed genes with putative function and gene ID from the Dappu V1.1 draft genome annotation, primer sequences, amplicon characteristics.

From: Predator-induced defences in Daphnia pulex: Selection and evaluation of internal reference genes for gene expression studies with real-time PCR

Gene symbol Gene name (putative) Function Gene ID P Primer sequences [5'→3'] L (bp) Localization in gene E (%)
aTub alpha Tubulin Cytoskeletal protein Dappu-301837 5 GCATGTTGTCCAACACTACTGC 135 3' exon 91
      CCTCAGAGAACTCTCCCTCCTC    
GAPDH Glyceraldehyde-3-phosphate dehydrogenase Glycolytic enzyme Dappu-302823 0 TGGGATGAGTCACTGGCATAC 136 3' exon 93
      GAAAGGACGACCAACAACAAAC    
Tbp TATA binding protein Transcription initiation Dappu-194512 0 CTACGATGCATTCGATAACATATACC 144 3' exon 90
      AGAACCAGCAATGAGTTAAACAAAG    
Stx16 Syntaxin 16 Protein involved in exocytosis Dappu-194044 0 CACATTGGTCGTCCTTAGTCTTG 148 3' exon 93
      TGCTATACGTTACGCTTGTCCTTAC    
Xbp1 X-box binding protein 1 Transcription factor Dappu-314438 0 CCGATATTCGAGACTGCAATG 131 3' exon 93
      AAAGATGGGTGAGCCAGAAATAC    
MMP Matrix metallo-proteinase Degradation of extracellular proteins Dappu-303491 0 CGAAACATGGACGCATAACTC 80 spanning penultimate 3' intron 92
      GTCCCAAAGTGTGACCGAAC    
CAPON C-terminal pdz ligand of neuronal nitric oxide synthase Location of neuronal nitric oxide synthase Dappu-100564 0 TAACGAGTCGGGAGGAAGTG 140 3' exon 94
      GCTGGACTTGAGCCAGTATCTC    
  1. Abbreviations: E: amplification efficiency; P: number of paralogs in D. pulex genome; L: length of the amplicon