Skip to main content

Table 5 Primer sequences of eight reference genes used in the validation study.

From: Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples

Target Gene Gene Accession
Number
Tm Primer Sequence
B2M NM_004048.2 55°C F-5'GTGCTCGCGCTACTACTCTCTCT
R-5'TCAATGTCGGATGGATGAAA
GAPDH NM_002046.2 55°C F-5'ACAGTCAGCCGCATCTTCTT
R-5'GACAAGCTTCCCGTTCTCAG
ACTB NM_001101.2 55°C F-5'CTCTTCCAGCCTTCCTTCCT
F-5'AGCACTGTGTTGGCGTACAG
HPRT1 NM_000194.1 55°C F-5'AAGCTTGCTGGTGAAAAGGA
R-5'AAGCAGATGGCCACAGAACT
YWHAZ NM_001135702.1 55°C F-5'ACTTTTGGTACATTGTGGC
R-5'CCGCCAGGAAAAACCAGT
18S NR_003286.2 60°C F-5'AGGAATTCCCAGTAAGTGCG
R-5'GCCTCACTAAACCATCCAA
RP II NM_000937.3 60°C F-5'CTTCACGGTGCTGGGCATT
R-5'GTGCGGCTGCTTCCATAA
UBC XM_002344708.1 60°C F-5'CCTGGTGCTCCGTCTTAGAG
R-5'TTTCCCAGCAAAGATCAACC