Skip to main content

Table 4 Primer sequences for generation of the 5' UTR constructs

From: Genetic variations regulate alternative splicing in the 5' untranslated regions of the mouse glioma-associated oncogene 1, Gli1

  Forward primer Reverse primer
L, LΔ1B 5'-GCGGCTAGC AGTAGGCAGTATAGGGTCC 5'-GCGGCTAGC GGCGTCTCAGGGAAGGAT
M, MΔ1B 5'-GCGGCTAGC TCCACCCAGCTCATCTTCTAG 5'-GCGGCTAGC GGCGTCTCAGGGAAGGAT
S, SΔ1B 5'-GCGGCTAGC CCAGCCCAGTTTCCAGCC 5'-GCGGCTAGC GGCGTCTCAGGGAAGGAT
  1. The NheI restriction sites are shown in Italics.