Skip to main content

Table 2 Primer sequences for real-time RT-PCR

From: Genetic variations regulate alternative splicing in the 5' untranslated regions of the mouse glioma-associated oncogene 1, Gli1

  Forward primers Reverse primers
L 5' - CATAAGCCCGGCACCCCCTCTCTA 5' - ACCCGCGAGAAGCGCAAACTTTTT
L+M 5' - ACGAGGGAAGTGAGCGGGAAGAGC 5' - ACCCGCGAGAAGCGCAAACTTTTT
E1B 5' - TTGTCCGCGCCTCTCCCACATACTA 5' - GGGCAGAAGCAGCCGTTCAGTCTT
ΔE1B 5' - TTGTCCGCGCCTCTCCCACATACTA 5'-TCAGGGAAGGATGAGGGGACCTG
E11-12 5' - CCCATAGGGTCTCGGGGTCTCAAAC 5'-GGAGGACCTGCGGCTGACTGTGTAA
Arp 5'-TGCACTCTCGCTTTCTGGAGGGTGT 5'-AATGCAGATGGATCAGCCAGGAAGG
Gapdh 5'-GGTGTGAACGGATTTGGCCGTATTG 5'-CCGTTGAATTTGCCGTGAGTGGAGT