Skip to main content

Advertisement

Table 4 Primers used in this study.

From: Elasmobranch qPCR reference genes: a case study of hypoxia preconditioned epaulette sharks

Gene Universal primers Forward/Reverse qPCR primers Forward/Reverse amplicon (bp) E
actc1 - CACCTTCCAGCAGATGTGGAT TACTGGGCGGGACTGAGATT 101 0.93
dnaja2 YRTGCGBRTYATGATHAGACA GACMSAVCCTGGYTCRATDACTTT AAGAAGGTGGTGAAAGAAGTGAAGA CAAAGTGCCTCAACAAGACCA 217 0.71
eef1b - GCTGTGGATGATGACGACGA GCACCCCAAAGTAAGCCATC 247 0.90
hprt GCTGAYCTVYTDGAYTACATCAA GGGCRTADCCYACMACRAAYTTGTC TCAATCCCAATGACGGTAGACTT AGTCTGCATTGTTTTACCCGTATC 161 0.83
mrip GRGTRGAGAGYGGYTACTT CARTCRAAKGTYTTBGAGCG ACAGTACCGCAGGGCAAAGT CCAATGCTTCTTCCACTGACC 126 0.92
polr2f ATGTCNGAYAACGARGAYAAYTT YTCRTCMMMNCCCCAGTC TGATGGAGATGACTTTGACGATG ACACGGGCTCGCTCATACTT 170 0.84
rpl6 - CACCAGGAGGGCGAGATCT TGGTCATCCTTCCGCTGTTC 71 0.96
tubb2 * CACCTTCATTGGCAACAGCAC GGCCTCTGTGAACTCCATCTC 98 0.91
ubq CYGGSAAGACCATCACCCT GGTSGACTCYTTCTGGATGTTGTA CTGGCAAACAGCTGGAAGA ATCTGCATGCCACCTCTCA 99 1.01
  1. For part of the genes universal primers were used to acquire novel Epaulette shark sequences. The amplicon length and PCR efficiency (E) of qPCR primers is displayed.
  2. * qPCR primer designed directly from the tubb2 alignment, see table 1