Skip to main content

Table 4 Primers used in this study.

From: Elasmobranch qPCR reference genes: a case study of hypoxia preconditioned epaulette sharks

Gene Universal primers
Forward/Reverse
qPCR primers
Forward/Reverse
amplicon (bp) E
actc1 - CACCTTCCAGCAGATGTGGAT
TACTGGGCGGGACTGAGATT
101 0.93
dnaja2 YRTGCGBRTYATGATHAGACA
GACMSAVCCTGGYTCRATDACTTT
AAGAAGGTGGTGAAAGAAGTGAAGA
CAAAGTGCCTCAACAAGACCA
217 0.71
eef1b - GCTGTGGATGATGACGACGA
GCACCCCAAAGTAAGCCATC
247 0.90
hprt GCTGAYCTVYTDGAYTACATCAA GGGCRTADCCYACMACRAAYTTGTC TCAATCCCAATGACGGTAGACTT
AGTCTGCATTGTTTTACCCGTATC
161 0.83
mrip GRGTRGAGAGYGGYTACTT
CARTCRAAKGTYTTBGAGCG
ACAGTACCGCAGGGCAAAGT
CCAATGCTTCTTCCACTGACC
126 0.92
polr2f ATGTCNGAYAACGARGAYAAYTT
YTCRTCMMMNCCCCAGTC
TGATGGAGATGACTTTGACGATG
ACACGGGCTCGCTCATACTT
170 0.84
rpl6 - CACCAGGAGGGCGAGATCT TGGTCATCCTTCCGCTGTTC 71 0.96
tubb2 * CACCTTCATTGGCAACAGCAC
GGCCTCTGTGAACTCCATCTC
98 0.91
ubq CYGGSAAGACCATCACCCT
GGTSGACTCYTTCTGGATGTTGTA
CTGGCAAACAGCTGGAAGA
ATCTGCATGCCACCTCTCA
99 1.01
  1. For part of the genes universal primers were used to acquire novel Epaulette shark sequences. The amplicon length and PCR efficiency (E) of qPCR primers is displayed.
  2. * qPCR primer designed directly from the tubb2 alignment, see table 1