Skip to main content

Table 1 List of candidate reference genes and genes of interest

From: Validation of reference genes for quantitative expression analysis by real-time RT-PCR in Saccharomyces cerevisiae

Name Molecular Function (SGD curated)/Biological process Primer sequence Eff
Candidate reference genes
ACT1 Structural constituent of cytoskeleton/Cell polarization, endocytosis, and other cytoskeletal functions F:ATTATATGTTTAGAGGTTGCTGCTTTGG
R:CAATTCGTTGTAGAAGGTATGATGCC
94
ALG9 Mannosyltransferase activity/Protein amino acid glycosylation F:CACGGATAGTGGCTTTGGTGAACAATTAC
R:TATGATTATCTGGCAGCAGGAAAGAACTTGGG
93
FPR2 Membrane-bound peptidyl-prolyl cis-trans isomerase activity/Unknown F:TCTTTATTAGAATCGGGAACTGTATTTGACTC
R:AATGACGCCTGGGACACCTCTTTC
89
HEM2 Porphobilinogen synthase activity/Heme biosynthesis F:TTCCGCTATTCATCTCCGATAATCCAG
R:ACAGACATCGCAAATAATATACAGTTCAGG
95
IPP1 Inorganic diphosphatase activity/Phosphate metabolic process F:CCCAATCATCCAAGACACCAAGAAGG
R:AGCAATAGTTTCACCAATTTCCAACACATC
90
KRE11 Unknown/ER to Golgi vesicle-mediated transport F:AACTGGTTCTGTTACCCAAATCAACTCAAC
R:AACGCTTCAATGTGACTTCTGTTTCCC
86
PDA1 Pyruvate dehydrogenase activity/Pyruvate metabolism F:ATTTGCCCGTCGTGTTTTGCTGTG
R:TATGCTGAATCTCGTCTCTAGTTCTGTAGG
93
RDN18 Sstructural constituent of ribosome/Translation F:AACTCACCAGGTCCAGACACAATAAGG
R:AAGGTCTCGTTCGTTATCGCAATTAAGC
93
RPN2 Protein binding, bridging/Ubiquitin-dependent protein catabolic process F:GCGGATACAGGCACATTGGATACC
R:TGTTGCTACCTTCTCTACCTCCTTACC
101
TAF10 RNA Pol II transcription factor activity/Transcription initiation and chromatin modification F:ATATTCCAGGATCAGGTCTTCCGTAGC
R:GTAGTCTTCTCATTCTGTTGATGTTGTTGTTG
96
TDH3 Glyceraldehyde-3P dehydrogenase (phosphorylating) activity/Glycolysis & Gluconeogenesis F:CGGTAGATACGCTGGTGAAGTTTC
R:TGGAAGATGGAGCAGTGATAACAAC
91
TFC1 RNA Pol III transcription factor activity/Transcription initiation on Pol III promoter F:GCTGGCACTCATATCTTATCGTTTCACAATGG
R:GAACCTGCTGTCAATACCGCCTGGAG
91
UBC6 Ubiquitin-protein ligase activity/ER-associated protein catabolic process F:GATACTTGGAATCCTGGCTGGTCTGTCTC
R:AAAGGGTCTTCTGTTTCATCACCTGTATTTGC
84
Genes of interest (GOIs) in glycogen metabolism
GPH1 Glycogen phosphorylase activity/Glycogen catabolic process F:ACAAAACTCAGCAGAAATTCACCACAAG
R:CAAGACGACCTAGACCACCATTACC
90
GSY2 Glycogen synthase activity/Glycogen biosynthetic process F:TGCCCAGTATAAAGACCATTACCACTTGATAGG
R:GCACCTTCAATCAGCCACCTCCCATAAAC
86
SGA1 glucan 1,4-alpha-glucosidase activity/Glycogen catabolic process F:TCCAAACGGATATTTCCTGGGTGGTACTGAG
R:GCATGATCTATTGTGTTTACATTAGCGGGTAG
89
  1. Function of candidate reference genes and GOIs as annotated in the SGD database http://db.yeastgenome.org. All ORF sequences were recovered from the SGD database. Forward (F) and reverse (R) primer sequences; PCR amplification efficiency (Eff). Genes highlighted in bold were selected from their apparent stability during growth on glucose (public microarray datasets from De Risi et al [26] and Gasch et al [27]). The remaining reference genes are commonly used internal controls in yeast studies.