Skip to main content

Table 1 DNA oligonucleotides

From: Molecular analysis of Ku redox regulation

Primer name Sequence (5'→3')
C493A* CGATTTCAGAGATTATTTCAGGC TCTGCTGCACAGAGC
C493S* CGATTTCAGAGATTATTTCAGTC TCTGCTGCACAGAGC
Sense ATACCGTCCCACCATCGGGC
Antisense GAATTCCTAAGCAGTCACTTGATCCTTTT
30A CCCCTATCCTTTCCGCGTCCTTACTTCCCC
30C GGGGAAGTAAGGACGCGGAAAGGATAGGGG
  1. * The underlined bases indicates the position of the mutation.