Skip to main content

Table 1 Oligonucleotides used in the study

From: Regulation of Neph3 gene in podocytes – key roles of transcription factors NF-κB and Sp1

Name Positiona Sequence 5'-3'
Primers for endogenous Neph3 mRNA detection
Neph3 5' +481-FW endogenous +481 to +499 TTAGGCCCGTGGAGCTAGA
Neph3 5' +702-RV endogenous +702 to +683 CATCTCGGAACCACAGCAAT
Primers for genomic DNA cloning
Neph3 5' -5070-FW genomic -5070 to -5051 ATCGCGGATCCCACAGGTCCCCCTACTGTGA
Neph3 5' +206-RV genomic +206 to +187 CCCAAGGTTCACGAGATTTG
Primers for reporter constructs
Neph3 5' +48-RV +48 to +31 GACAGATCTCTCTGACGCTCTGAAACG
Neph3 5' -5070-FW -5070 to -5053 GACACGCGTCACAGGTCCCCCTACTGT
Neph3 5' -4543-FW -4543 to -4523 GACACGCGTCCTTGTCTCACTACTCACAGC
Neph3 5' -3877-FW -3877 to -3860 GACACGCGTGTGATCCATCTGCCTCAG
Neph3 5' -2260-FW -2260 to -2240 GACACGCGTCTGTTTGAGACTCTCTCGCTC
Neph3 5' -1072-FW -1072 to -1053 GACACGCGTCTGTCACCCTCTTCCAAGTG
Neph3 5' -536-FW -536 to -518 GACACGCGTGACGTGCTGTAGTTTGCAG
Neph3 5' -366-FW -366 to -352 GACACGCGTGGAAACTGGCGAGGC
Neph3 5' -162-FW -162 to -145 GACACGCGTCAGACCCCAATTGAGCTG
Neph3 5' -105-FW -105 to -89 GACACGCGTCATTCATCCGCGTCTCA
Primers for site-directed mutagenesis b
Neph3 5'-118/NF-κB mutation -96 to -62 GCGTCTCAGCCGCTTA A GTTTCTCAACGGGAAGAG
Neph3 5'-118/Sp1 mutation -77 to -47 TTCTCAACGGGAAGAGAAT G GAGCTCCCGGG
Primers for ChIP
Neph3-5' -81-FW ChIP -81 to -62 GAGTTTCTCAACGGGAAGAG
Neph3-5' +50-RV ChIP +50 to +32 GCCTCTGACGCTCTGAAAC
  1. aPositions in genomic sequence [GenBank: AC002133] related to Neph3 transcription start site.
  2. bFor oligonucleotides used in mutagenesis, only the sense primer is shown. The core element is underlined and the mutated oligonucleotides are shown in bold.