Skip to main content

Advertisement

Table 2 List of primers and reference genes under investigation

From: Construction of an adult barnacle (Balanus amphitrite) cDNA library and selection of reference genes for quantitative RT-PCR studies

Gene Gene's symbol Accession number Forward primer Reverse primer Amplicon length Primer efficiency
Ubiquitin c ubc FM882773 GCGTCATAAGTTGCGGAGA TCTTGGCCTTCACATTTTCA 106 100%
Fructose bisphosphate aldolase ald FM882346 TATGTCCCAGCGTTGTGCT TGGCACCAGACCATTCATT 166 Non-specific products
NADH dehydrogenase subunit 1 mt-nd1 FM882393 CGGGCTGTTGCTCAAACTA TTCGACAAAATCTTCCAATCT 102 100%
Tubulin alpha tuba FM882619 CCTGCTGGGAGCTGTATTGT ACAACAGTGGGCTCCAAATC 169 94%
NADH dehydrogenase subunit 4L mt-nd4L FM882472 TTCTTGGTAGCTTCTGTGTGTG TAGTCGGAACCATGTGATCG 80 100%
Tubulin beta tubb FM882322 ACCTCAGCCTGGTCATCATC GGCTTTCCTCCACTGGTACA 165 84%
Cysteine protease 1 cp1 FM882273 GTTGAGCAGCACATGAAGGA CGAACTCCTCAGAGGTCAGG 91 94%
Cytochrome b mt-cyb FM882286 GGACACTGCATGCTAATGGA AGGCAGCAGCCATAGTCAAG 144 91%
Acyl carrier mt-acp FM882501 GATGTGGCGATTTGCTATCC TTCTCCGGGTTGATCTTGTC 175 93%
Myosin 1-light chain mlc1 FM882394 AAGGATGAGGTTGACGCCTA ACCCTGGTCCTTGTCCTTCT 174 Presence of primer dimers
60s ribosomal protein L15 rplL5 FM882400 AAGCAGGGATACGCCATCTA AGCTTCAGCTCGTTCACTCC 116 84%
Glyceraldehyde-3-phosphate dehydrogenase gapdh FM882736 TCTGCGGCTTACTTGTCCTT ACTCGCACTCGAGCATCTTT 154 Non-specific products
Elongation Factor 1 alpha ef1a FM882302 GCCACAGGGATTTCATCAAG TGGAGATACCAGCCTCGAAC 105 100%
Actin alpha act FM882301 CAGTCCAAGCGTGGTATCCT CGCACGCAGCTCGTTGTAGA 114 100%