Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 List of primers and reference genes under investigation

From: Construction of an adult barnacle (Balanus amphitrite) cDNA library and selection of reference genes for quantitative RT-PCR studies

Gene Gene's symbol Accession number Forward primer Reverse primer Amplicon length Primer efficiency
Fructose bisphosphate aldolase ald FM882346 TATGTCCCAGCGTTGTGCT TGGCACCAGACCATTCATT 166 Non-specific products
NADH dehydrogenase subunit 1 mt-nd1 FM882393 CGGGCTGTTGCTCAAACTA TTCGACAAAATCTTCCAATCT 102 100%
Myosin 1-light chain mlc1 FM882394 AAGGATGAGGTTGACGCCTA ACCCTGGTCCTTGTCCTTCT 174 Presence of primer dimers
60s ribosomal protein L15 rplL5 FM882400 AAGCAGGGATACGCCATCTA AGCTTCAGCTCGTTCACTCC 116 84%
Glyceraldehyde-3-phosphate dehydrogenase gapdh FM882736 TCTGCGGCTTACTTGTCCTT ACTCGCACTCGAGCATCTTT 154 Non-specific products
Elongation Factor 1 alpha ef1a FM882302 GCCACAGGGATTTCATCAAG TGGAGATACCAGCCTCGAAC 105 100%