Skip to main content

Table 2 Target genes, product sizes and primer sequences used for quantitative real-time PCR

From: Liver-enriched transcription factors are critical for the expression of hepatocyte marker genes in mES-derived hepatocyte-lineage cells

Target genes Sequences of primer (5'-3') Product sizes (kB)
CEBP-α (NM_007678.2)   
   Forward gctttttgcacctccaccta 170
   Reverse ccacaaagcccagaaaccta  
CEBP-β (NM_009883.1)   
   Forward caagctgagcgacgagtaca 157
   Reverse cagctgctccaccttcttct  
HNF-1β (NM_009330.2)   
   Forward gacactcctcccatcctcaa 156
   Reverse ctccctctgggggatattgt  
HNF-3α (NM_008259.2)   
   Forward cagcacaagctggacttcaa 173
   Reverse agcacgggtctggaatacac  
HNF-3β (NM_010446.1)   
   Forward taagcgagctaaagggagca 176
   Reverse agagaaggggtggttgaagg  
HNF-4α (NM_008261.2)   
   Forward agaggttctgtcccagcaga 169
   Reverse atccagaaggagttcgcaga  
HNF-6 (NM_008262.2)   
   Forward ctgtgaaactcccccaggta 179
   Reverse tgaaactaccgctcacgttg  
GAPDH (NM_199472.1)   
   Forward acccagaagactgtggatgg 172
   Reverse cacattgggggtaggaacac  
  1. Abbreviation: HNF = hepatocyte nuclear factor, C/EBP = CCAAT-enhancer binding protein, GAPDH = glyceraldehyde-3-phosphate dehydrogenase