Skip to main content

Table 1 Target genes, primer sequences, product sizes and primer-specific annealing temperatures (AT) used for PCR

From: Liver-enriched transcription factors are critical for the expression of hepatocyte marker genes in mES-derived hepatocyte-lineage cells

Target genes Sequences of primer (5'-3') Product sizes (kB) AT (°C)
AFP (NM_007423.3)    
   Forward cactgctgcaactcttcgta 300 55
   Reverse ctttggaccctcttctgtga   
Albumin (NM_009654.1)    
   Forward tgaactggctgactgctgtg 718 55
   Reverse catccttggcctcagcatag   
HNF-3β (NM_010446.1)    
   Forward actggagcagctactacg 169 55
   Reverse cccacataggatgacatg   
Cyp3a (NM_007818.2)    
   Forward tacagcatggatgtgatca 380 55
   Reverse tcatacccagcaaaaataaa   
G6Pase (NM_008061.2)    
Forward caggactggttcatcctt 210 55
   Reverse gttgctgtagtagtcggt   
Pepck (NM_011044.1)    
   Forward tctgccaaggtcatccagg 290 60
   Reverse gttttggggatgggcactg   
TAT (NM_146214.1)    
   Forward accttcaatcccatccga 206 57
   Reverse tcccgactggataggta   
TDO (NM_019911.2)    
   Forward agagccagcaaaggaggac 500 55
   Reverse ctgtctgctcctgctctgat   
Pou5f1 (NM_013633.2)    
   Forward ggcgttctctttggaaaggtgttc 313 55
   Reverse ctcgaaccacatccttctct   
  1. Abbreviation: HNF-3b = hepatocyte nuclear factor-3β, AFP = α-fetoprotein, Cyp3a = cytochrome P450-3a, G6Pase = glucose-6-phosphatase, Pepck = phosphoenolpyruvate carboxykinase, Pou5f1 = POU domain class5 transcription factor 1, TAT = tyrosine aminotransferase, TDO = tryptophan 2,3-dioxygenase, GAPDH = glyceraldehyde-3-phosphate dehydrogenase.