Skip to main content

Table 1 Genes examined

From: Reverse transcription-quantitative polymerase chain reaction: description of a RIN-based algorithm for accurate data normalization

Gene symbol Gene name GenBank accession no. Primer sequences (5'→ 3') Amplicon size (bp) qPCR efficiency (%)
Control gene (assessment of RT-qPCR inhibitors)
CAB A. thaliana chlorophyll a/b-binding protein X56062 F: CCATTGCATTTGTTGAGCAC
R: CAATTCCTCGAGCTTCTTGG
119 100
Target genes – training set
18S 18S ribosomal RNA X03205 F: GGCGCCCCCTCGATGCTCTTAG
R: GCTCGGGCCTGCTTTGAACACTCT
89 98
ACTB Beta-actin NM_001101 F: CTGTGGCATCCACGAAACTA
R: AGTACTTGCGCTCAGGAGGA
200 100
ATUB Alpha tubulin NM_006082 F: TTACCTCGACTCTTAGCTTGTCG
R: GGATGGAGATGCACTCACG
107 92
B2M Beta-2-microglobulin NM_004048 F: CACCCCCACTGAAAAAGATG
R: ATATTAAAAAGCAAGCAAGCAGAA
167 93
GAPDH Glyceraldehyde-3-phosphate dehydrogenase NM_002046 F: TGCACCACCAACTGCTTAGC
R: GGCATGGACTGTGGTCATGAG
87 100
HPRT Hypoxanthine phosphoribosyl transferase 1 NM_000194 F: TGATAGATCCATTCCTATGACTGTAGA
R: AAGACATTCTTTCCAGTTAAAGTTGAG
126 94
POLR2L Polymerase RNA II polypeptide L NM_021128 F: CAACAAGTGGGAGGCTTACCT
R: AGCTTCTCGATCAGGTCCAC
132 98
PSMB6 Proteasome subunit Y NM_002798 F: GATACCGGGAAGACCTGATG
R: AATGGCAAAGGACTGCCTTA
116 99
RPLP0 Ribosomal protein, large, P0 NM_001002 F: CACTGAGATCAGGGACATGTTG
R: CTTCACATGGGGCAATGG
113 100
Target genes – validation set
EGFR Epidermal growth factor receptor NM_005228 F: CTGGATCCCAGAAGGTGAGA
R: GCCATCACGTAGGCTTCATC
111 100
HER2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2 NM_004448 F: CTCCTCCTCGCCCTCTTG
R: AGCATGTCCAGGTGGGTCT
107 90
HER3 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 NM_001982 F: GTGGACTCGAGCAACATTGA
R: CCGTACTGTCCGGAAGACAT
147 97
  1. Forward and reverse primer sequences are indicated by "F" and "R", respectively.