Skip to main content

Table 5 Primer sequences and amplification summary

From: Selection of suitable housekeeping genes for expression analysis in glioblastoma using quantitative RT-PCR

Gene Primer Sequence [5' → 3'] Amplicon size (bp) Intervening sequence size (bp) Amplification efficiency (%)
ACTB F: GGCACCCAGCACAATGAAG
R: CCGATCCACACGGAGTACTTG
66 178 98
GAPDH F: AGATCCCTCCAAAATCAAGTGG
R: GGCAGAGATGATGACCCTTTT
130 220 98
GUSB F: GAAAATATGTGGTTGGAGAGCTCATT
R: CCGAGTGAAGATCCCCTTTTTA
101 3360 93
HMBS F: CACGATCCCGAGACTCTGCT
R: TACTGGCACACTGCAGCCTC
81 315 104
HPRT1 F: TGAGGATTTGGAAAGGGTGT
R: GAGCACACAGAGGGCTACAA
118 1833 99
TBP F: GAGCTGTGATGTGAAGTTTCC
R: TCTGGGTTTGATCATTCTGTAG
117 1747 110
18S rRNA F: GGAGTATGGTTGCAAAGCTGA
R: ATCTGTCAATCCTGTCCGTGT
129 _ 89
TG1 F: AAGGTCGGAAGAAGGTGACAG
R: GCTGCTGGAATTTGCTCACTG
120 4217 97
TG2 F: CTTTACCCAGCGACCGTTTCA
R: GGACTCAAGTAGGGCACAGAA
123 2206 96
TG3 F: TACTCTGATCGCTCCGTTAGG
R: CCTGCAAATGCCAGTGTCGTA
120 29982 92
TG4 F: AAAGATGCTGGGCAGTGCATC
R: CCACAGGAGTATCTTGCACAG
94 2754 90
TG5 F: GCCAACCCTTCGAAACATCTG
R: AGCTGCCAAAGTATTCACAGTC
130 242 110
TG6 F: AGCGCTGTGGTCGTTTGGAG
R: GACGAATAACCAGGTGGAGCT
132 231 101
TG7 F: TTGCCACAGGTGGGAAAGAGA
R: CAGTCATTCCGCACGTTCTTG
94 256 99
TG8 F: GAAGGGATGTACGTGTGACTC
R: CCATTCTCTGGGAGATGAAGC
131 2129 98
TG9 F: GCCGAAGCTTTGAACATGCAC
R: CACACTCAGCAACTGTCCTAG
93 4817 110
TG10 F: CTCTCCTGCTCTAGGATCAAG
R: ATTCCGCTGCTGACACCTAAC
124 3241 96
TG11 F: GAACAGTGGGCAGTGATTCAC
R: TTGGTGTCCTGTGGCTTAGTC
125 1351 87
TG12 F: CGGATTTCAGGAAGCCTTGTG
R: GCAGATGCTTGCACAGCATTC
131 4426 90
  1. F: forward primer, R: reverse primer