Skip to main content

Table 1 Details of the quantitative RT-PCRs of Bm86 and the candidate reference genes evaluated in this study.

From: Selection of reference genes for quantitative RT-PCR studies in Rhipicephalus (Boophilus) microplus and Rhipicephalus appendiculatus ticks and determination of the expression profile of Bm86

Symbol Gene name Function GenBank accession number Forward primer Reverse primer Amplicon length Efficiency
    Rm a Ra a     Rm a Ra a
ACTB Beta actin Cytoskeletal structural protein AY255624 AY254899 CCCATCTACGAAGGTTACGCC CGCACGATTTCACGCTCAG 139 bp 102 98
Bm86 Bm86 Unknown FJ809946 FJ809944 CGTCCCGACTTGACCTGC AGGAGCGGCTGAACAGTTTG 101 bp 103 103
BTUB Beta tubulin Component of microtubules CK179480 CD781348 AACATGGTGCCCTTCCCACG GCAGCCATCATGTTCTTTGC 140 bp 92 97
ELF1A Elongation factor 1-alpha Component of the eukaryotic translational apparatus EW679365 CD797149 CGTCTACAAGATTGGTGGCATT CTCAGTGGTCAGGTTGGCAG 108 bp 100 92
GAPDH Glyceraldehyde-3-phosphate dehydrogenase Oxireductase in glycolysis and gluconeogenesis CK180824 CD791831 AGTCCACCGGCGTCTTCCTCA GTGTGGTTCACACCCATCACAA 123 bp 97 91
GST Glutathione S-transferase Detoxification of endobiotic and xenobiotic substrates CV456312 CD789942 TACCTGGGCAAGAAGCACGG AGAGCCCAGAGCAGGTCGTTG 98 bp 93 100
H3F3A H3 Histone family 3A Involved in structure of chromatin CV442167 CD795637 AAGCAGACCGCCCGTAAGT GTAACGACGGATCTCCCTGAG 152 bp 92 95
PPIA Cyclophilin Facilitate protein folding CV445080 CD793819 CTGGGACGGATAGTAATTGAGC ATGAAGTTGGGGATGACGC 133 bp 95 98
RPL4 Ribosomal protein L4 Structural component of the large 60S ribosomal subunit CV447629 CD794864 AGGTTCCCCTGGTGGTGAG GTTCCTCATCTTTCCCTTGCC 152 bp 93 98
TBP TATA box binding protein Transcription factor CV453818 CD780134 CTTGTCCTCACACACAGCCAGTT GTGAGCACGACTTTTCCAGATAC 122 bp 94 100
  1. aRm, R. microplus; Ra, R. appendiculatus