Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers used for the detection of specific ER genes

From: Innovative approach for transcriptomic analysis of obligate intracellular pathogen: selective capture of transcribed sequences of Ehrlichia ruminantium

Primer name Primer sequence Target gene or sequence Product size (bp) source (references)
ffh-F2 a 5' GGTAGGTCTTCAAGGTGTTGGTAAA 3' Ffh 121 this work
recA-F1 a,b 5' TTGAAAAAGCGTTTGGTCGTG 3' recA 121 this work
rpoD-F1 a,b 5' CAGAGGGTTGCAATTTCTTGATT 3' rpoD 121 this work
16S-F1a b 5' AGCGCAACCCTCATCCTTAG 3' rRNA 16S 121 this work
map1gardF a,b 5' CACTTGAAGGAATGCCAGTTTCTC 3' map1 85 this work
AB128 5' ACTAGTAGAAATTGCACAATCTAT 3' pCS20 278 Martinez et al., 2004
NKpn1-pdN9 5' GTGGTACCGCTCTCCGTCCGANNNNNNNNN 3' Kpn I / Daigle et al., 2001
NKpn1 5' GTGGTACGGCTCTCCGTCCGA 3' NKpn I tag 200-400  
  1. a: pair of primers use for RT-PCR
  2. b: pair of primers use for qRT-PCR