Skip to main content

Advertisement

Table 1 Primers used for the detection of specific ER genes

From: Innovative approach for transcriptomic analysis of obligate intracellular pathogen: selective capture of transcribed sequences of Ehrlichia ruminantium

Primer name Primer sequence Target gene or sequence Product size (bp) source (references)
ffh-F2 a 5' GGTAGGTCTTCAAGGTGTTGGTAAA 3' Ffh 121 this work
ffh-R2 5' AGTTTGAGCTGCAGGACGATATAA 3'    
recA-F1 a,b 5' TTGAAAAAGCGTTTGGTCGTG 3' recA 121 this work
recA-R1 5' GGGAAACCACCAATACCCAAT 3'    
rpoD-F1 a,b 5' CAGAGGGTTGCAATTTCTTGATT 3' rpoD 121 this work
rpoD-R1 5' TCTGACCCACCATGTTGCAT 3'    
16S-F1a b 5' AGCGCAACCCTCATCCTTAG 3' rRNA 16S 121 this work
16S-R1 5' AGCCCACCCTATAAGGGCC 3'    
map1gardF a,b 5' CACTTGAAGGAATGCCAGTTTCTC 3' map1 85 this work
map1gardR 5' CTTAGGATTTGTAGCATTGATTACTGACACT 3'    
AB128 5' ACTAGTAGAAATTGCACAATCTAT 3' pCS20 278 Martinez et al., 2004
AB129 5' TGATAACTTGGTGCGGGAAATCCTT 3'    
NKpn1-pdN9 5' GTGGTACCGCTCTCCGTCCGANNNNNNNNN 3' Kpn I / Daigle et al., 2001
NKpn1 5' GTGGTACGGCTCTCCGTCCGA 3' NKpn I tag 200-400  
ARN16SGarF 5' AACTTGAGAGTTTGATCCTGGCT 3' rRNA 16S 1503 this work
ARN16SGarR 5' AGGAGGTAATCCAGCCGCAGGTT 3'    this work
ARN5SGarR 5' TCTCCCGTGCCTTAAGACAAA 3' rRNA 23S 2935 this work
ARN23SGarF 5' TTGATGGATGCCTTGGCGTTAA 3' rRNA 5S   this work
  1. a: pair of primers use for RT-PCR
  2. b: pair of primers use for qRT-PCR