Skip to main content

Advertisement

Table 3 Primers used to amplify probes for in situ hybridization.

From: Characterization of the transcripts and protein isoforms for cytoplasmic polyadenylation element binding protein-3 (CPEB3) in the mouse retina

Probe Forward primer Reverse primer
CPEB3-antisense 5'ACAGAGCCAGCTGCGCAAACCA3' 5'GTAATACGACTCACTATAGGG GAAGGTGCCTCCGAAGACCG3'
CPEB3-sense 5'GTAATACGACTCACTATAGGG ACAGAGCCAGCTGCGCAAACCA3' 5'GAAGGTGCCTCCGAAGACCG3'
  1. The sequence in bold is T7 promoter.