Open Access

Expression of HNF4alpha in the human and rat choroid plexus – Implications for drug transport across the blood-cerebrospinal-fluid (CSF) barrier

BMC Molecular Biology200910:68

DOI: 10.1186/1471-2199-10-68

Received: 01 December 2008

Accepted: 03 July 2009

Published: 03 July 2009

Abstract

Background

The choroid plexus consists of highly differentiated epithelium and functions as a barrier at the interface of the blood-cerebrospinal-fluid (CSF). This tissue may therefore determine the bioavailability and transport of drugs to the brain. Little is known about the expression of drug and xenobiotic metabolizing enzymes (DME) and of drug transporters in the human choroid plexus. Notably, the transcription factor and zinc finger protein HNF4alpha is a master regulator of DMEs and of drug transporters. As of today its activity in the blood-CSF barrier is unknown. Here we report our efforts in determining HNF4alpha activity in the regulation of ABC transporters in the human and rat choroid plexus.

Results

We report expression of HNF4alpha by qRT-PCR and by immunohistochemistry and evidence transcript expression of the ATP-binding cassette transporters ABCB1, ABCB4, ABCC1-6 in choroid plexus. Additionally, HNF4alpha DNA binding activity at regulatory sequences of ABCB4 and ABCC1 was determined by EMSA bandshift assays with a specific antibody. We then performed siRNA mediated functional knock down of HNF4alpha in Caco-2 cells and found ABCC1 gene expression to be repressed in cell culture experiments.

Conclusion

Our study evidences activity of HNF4alpha in human and rat choroid plexus. This transcription factor targets DMEs and drug transporters and may well determine availability of drugs at the blood-CSF barrier.

Background

Drug delivery to the brain is mediated by several factors, most notably transport across the blood brain (BB) and the choroid plexus barrier; the latter displays drug-metabolizing enzyme and drug transport activity. It may therefore determine the overall cerebral bioavailability of drugs [1]. Specifically, the choroid plexus is located within brain vesicles. It is composed of a tight monolayer of polarized epithelial cells and forms the blood-cerebrospinal-fluid (CSF) barrier. Together with the blood-brain barrier, formed by endothelial cells of brain capillaries, it functions as the main interface between the central nervous system (CNS) and the peripheral circulation. Within the CNS this tissue is of great pharmacological interest, but information on the expression of efflux transporters such as the ATP binding cassette (ABC) proteins is missing [2]. In contrast, their expression in liver, kidney, and intestine has been studied in considerable detail [35]. Indeed, the ABC drug transporters extrude a variety of structurally diverse drugs, drug conjugates and metabolites in an active, ATP-dependent manner and even against high concentration gradients. The three main ABC families considered to be involved in the disposition of xenobiotics include the ABCB family (MDR subfamily, multidrug resistance, e.g. ABCB1/MDR1), the ABCC family of multidrug resistance proteins (MRP subfamily, multidrug resistance related proteins, e.g. ABCC2/MRP2), and the breast cancer resistance protein (ABCG2/BCRP) of the ABCG family [3, 4]. However, comprehensive studies on the expression levels of ATP transporters in the human choroid plexus have not been attempted.

Notably, there is clear evidence for HNF4α to play a role in the transcriptional control of drug transporters. Specifically, HNF4α is a member of the nuclear receptor superfamily and one of the key players in liver biology [68]. Among the genes regulated by HNF4α are a broad range of xenobiotic-metabolizing cytochrome P450 isozymes [9, 10], UDP-glucuronosyltransferases [11], sulfotransferases [12] and transporters including organic anion transporter 2 [13], organic cation transporter 1 [14], the ABC transporter ABCC2 [15], ABCC6 [16], ABCG5 [17] and ABCG8 [17]. Although there is clear evidence for HNF4α to be of key importance in the control of drug metabolism it may also play a role in the regulation of transporters in the choroid plexus. Here we report our efforts in mapping HNF4α to human and rat choroid plexus. We determined HNF4α DNA binding activity and searched for transcript expression of various ABCB and ABCC transporters in the human choroid plexus. Apart from qRT-PCR and immunohistochemistry studies we evidence ABCC1 gene expression to be highly dependent on HNF4α as determined in functional knock down studies. Overall, we provide evidence for HNF4α to be an important regulator of ABC drug transporters in the choroid plexus and thus may impact efficacy of pharmacotherapy targeted to the brain.

Results

Initially, we searched for HNF4α transcripts in individual samples of human and rat choroid plexus and confirmed gene expression of HNF4α by quantitative real time RT-PCR (Figures 1A). We found HNF4α transcript expression in human and rat choroid plexus to account for approximately a tenth of its expression in the liver (Figures 1A). It is of considerable importance that HNF4α expression in the human and rat choroid plexus is restricted to P1 promoter driven isoforms (Table 1). Furthermore, we studied expression of the insulin-like growth factor 2 (IGF2), transthyretin (TTR) and the transcription factor FOXJ1 to further qualify choroidal epithelial cells of the brain [18, 19]. These transcripts are specifically enriched in choroid plexus. We observed abundant expression of IGF2, TTR and FOXJ1 in human choroid plexus as compared to total brain RNA extracts (Figures 1B). There is the need to study histological well qualified tissue, as studies with total brain RNA extracts would render findings meaningless as will be discussed later on. Unfortunately, sufficient human choroid plexus tissue suitable for the harvest of nuclear protein and to perform western blotting as well as EMSA assay could not be obtained. We nonetheless demonstrate HNF4α protein expression by immunohistochemistry by use of a specific HNF4α antibody for human (Figures 2A) and rat choroid plexus (Figures 2C). To confirm specificity an excess of antigen preabsorbed to the antibody was used (Figures 2B, D).
Table 1

HNF4α isoform expression in human and rat choroid plexus.

Patient

HNF4αP1

HNF4αP2

Patient 100-04

0.0342

0

patient 44-04

0.0025

0

patient 62-04

0.4110

0

Animal

HNF4αP1

HNF4αP2

rat 1

0.097

0

rat 2

0.348

0

rat 3

0.158

0

HNF4αP1 and P2 gene expression was measured in human and rat choroid plexus (n = 3, respectively) by real-time quantitative RT-PCR and computed relative to expression of mitATPase6, which served as a housekeeping gene. Patient characteristics are given in Table 5. Caco-2 cells and pancreatic tissue served as controls for HNF4αP2 expression in human and rats, respectively.

https://static-content.springer.com/image/art%3A10.1186%2F1471-2199-10-68/MediaObjects/12867_2008_Article_436_Fig1_HTML.jpg
Figure 1

Gene expression of HNF4α and different ABC transporters in the choroid plexus. Gene expression of HNF4α and different ABC transporters in the choroid plexus. A: HNF4α gene expression in human (n = 3) and rat choroid plexus (n = 3) was measured by quantitative real-time RT-PCR and determined relative to expression of mitATPase6, which served as a housekeeping gene. Expression levels were compared to liver and total brain. Mean values + SD are shown. B and C: Gene expression of FOXJ1, IGF2 and TTR (B) and of different members of the ABCB and ABCC family (C) was analyzed in human choroid plexus by quantitative real-time RT-PCR and determined relative to expression of mitATPase6, which served as a housekeeping gene. Expression levels were compared to liver (n = 4) and total brain. Mean values + SD are shown.

https://static-content.springer.com/image/art%3A10.1186%2F1471-2199-10-68/MediaObjects/12867_2008_Article_436_Fig2_HTML.jpg
Figure 2

Immunohistochemical detection of HNF4α in the choroid plexus. Slices of human (A, B) and rat (C, D) choroid plexus probes were stained with polyclonal antibodies against HNF4α. Arrows indicate representative HNF4α positive cells (A, C). To confirm specificity of the immunohistochemical localization antibodies were preabsorbed with excess of antigens for HNF4α (B, D). Patient identification numbers were indicated respectively and patient characteristics are given in Table 5. Magnification ×400.

We then analyzed expression of different members of the ABCB (MDR subfamily, multidrug resistance)/ABCC (MRP subfamily, multidrug resistance related) gene families in the human choroid plexus by quantitative real time RT-PCR and report results for n = 3 individual human choroid plexus samples. mRNA expression of ABCB4 (MDR2/3), ABCC1 (MRP1), ABCC2 (MRP2), ABCC3 (MRP3), ABCC4 (MRP4), ABCC5 (MRP5) and ABCC6 (MRP6) was comparable to its expression level in commercially available control total human brain RNA extracts (Figures 1C). mRNA expression of ABCB1 (MDR1) determined in choroidal epithelium was lower than in human liver (n = 4) and in brain (Figures 1C).

We then searched for HNF4α binding sites in proximal promoter sequences (up to -7000 bp) of drug transporter coding genes. For this purpose, we used two different bioinformatic approaches (see Material and Methods section for a description of the employed algorithms). We observed three binding sites within the ABCB4 promoter, spaced approximately by 600 bp and 1600 bp and two recognition sites within the ABCC1 promoter (Table 2). Predicted binding sites were confirmed by EMSA band shift assays. We used 32P-labeled double-stranded DNA probes to specifically probe for HNF4α-sites located in the human ABCB4 (hABCB4_1, hABCB4_2 and hABCB4_3) and in the human ABCC1 (hABCC1_1, hABCC1_2) gene. Note, DNA binding of nuclear extracts to the A-site of the HNF1α-promoter (HNF1pro) served as a positive control. This site is an established recognition site for HNF4α. Unfortunately, sufficient amount of human choroid plexus suitable for the isolation of nuclear protein could not be obtained. Instead, we used nuclear extracts isolated from the human intestinal cell line Caco-2 which expresses several ABC transporter genes [20] and therefore is a rich source of HNF4α nuclear protein. Indeed, HNF4α protein expression in Caco-2 cells is comparable to organs such as the liver [21]. As depicted in Figures 3A we observed strong binding of HNF4α to the A-site of the HNF1α-promoter. We also observed strong binding of HNF4α to the predicted sites in the promoters of ABCB4 and ABCC1 (Figures 3A); bands could be shifted with a specific HNF4α antibody therefore demonstrating selectivity and specificity of the assay. Alignment of human, rat and mouse ABCB4 and ABCC1 genes did not identify common HNF4alpha binding sites. This points to differences in the molecular organization of ABC promoters in orthologous genes. HNF4alpha binding sites for the rat and mouse ABCB4 and ABCC1 genes are given in Table 2, whereas the sequences of oligonucleotides to confirm the predicted sites experimentally are shown in Table 3. As shown in Figures 3B and 3C EMSA band shift assays confirmed binding of HNF4α to rat and mouse ABCB4 and ABCC1 targeted sequences.
Table 2

Predicted binding sites for HNF4α in ABC genes.

Gene name

Accession number

bp relative to transcription start site

Score core/matrix

 

Human

    

ABCB4

NM_000443.3

-6274 to -6252

V$zemlin13_11045

1.000/0.896

  

-4680 to -4658

V$HNF4_01

1.000/0.990

   

V$zemlin13_1104

1.000/0.997

  

-4063 to -4041

V$HNF4_01

1.000/0.954

   

V$zemlin13_11045

1.000/0.958

ABCC1

NM_004996.3

-1756 to -1734

V$HNF4_01

0.915/0.925

  

-5266 to -5244

V$HNF4_01

1.000/0.944

   

V$zemlin13_11045

1.000/0.969

Rat

    

ABCB4

NM_012690.1

-4584 to -4562

V$zemlin13_11045

1.000/0.894

  

-39 to -17

V$HNF4_01

1.000/0.943

   

V$zemlin13_11045

1.000/0.978

ABCC1

NM_022281.2

-2146 to -2124

V$HNF4_01

1.000/0.908

Mouse

    

ABCB4

NM_008830.2

-5281 to -5259

V$zemlin13_11045

1.000/0.907

ABCC1

NM_008576.2

+2626 to +2648 (Intron 1)

V$HNF4_01

1.000/0.924

   

V$zemlin13_11045

1.000/0.910

Transfac matrix (V$HNF4_01) or self-generated matrix (V$zemlin13_11045) with a setting of core and matrix similarity 0.9 was used.

Table 3

Shift-probes sequences.

Gene

Oligo name

Sequence

Human

  

HNF1α

HNF1pro

AGGGCTGA AGTCCA A AGTTCA GTCCCTTC

ABCB4

hABCB4_1 (GS49)

AGAA AGGTCA A AGGCAA AGCA

 

hABCB4_2 (GS50)

GTGC AGGGCA A AGGTCA GATT

 

hABCB4_3 (GS51)

GCTA AGTCCA A AGATCA ATTC

ABCC1

hABCC1_1 (GS48)

TTGAC AGTATA A AGGTCA AGCAA

 

hABCC1_2 (GS171)

TTCAT AGAGCA A AGTACA GCAAC

Rat

  

ABCB4

rABCB4_1 (GS166)

AGAAG CCCTCA A AGTCCA CCTAT

 

rABCB4_2 (GS167)

CGCAG CGAGCA A AGTCCA GGTCT

ABCC1

rABCC1_1 (GS169)

GACAC GGGCCA A AGACCC ACAGA

Mouse

  

ABCB4

mABCB4_1 (GS168)

ATAGC CATGCA A AGTCCA AAAGA

ABCC1

mABCC1_1 (GS170)

TCCCT TGTGCA A AGGTCT AGGAT

The central five nucleotides of the HNF4α binding site are highlighted in bold letters. The two direct repeats (DR1) separated by a spacer of one nucleotide are underlined.

https://static-content.springer.com/image/art%3A10.1186%2F1471-2199-10-68/MediaObjects/12867_2008_Article_436_Fig3_HTML.jpg
Figure 3

HNF4α binding to promoters of ABCB4 and ABCC1. Electrophoretic mobility shift assays with 2,5 μg Caco-2 cell nuclear extract and oligonucleotides corresponding to the A-site of the HNF1α promoter (HNF1pro) and to putative HNF4α binding-sites within human (A), rat (B) and mouse (C) ABCB4 and ABCC1 as 32P labeled probe. In supershift assays an antibody directed against HNF4α (+) was added. For oligonucleotide sequence information see Table 2 and 3.

To further probe for the role of HNF4α in ABC gene regulation we employed an siRNA approach. Specifically, siRNA-mediated functional knock down of HNF4α in the human Caco-2 cell line resulted in significantly decreased gene expression of ABCC1 (Table 4; for transfection efficiency and stable expression of mitATPase6 after transfection see Niehof and Borlak, 2008 [22]). These results confirm ABCC1 to be a gene target of HNF4α. ABCB4 expression in Caco-2 cells is near the limit of detection. Consequently, knockdown experiments are not meaningful.
Table 4

Functional knock down of HNF4α in cultures of human Caco-2 cells.

Gene

Gene expression 48 h after HNF4α siRNA transfection [%]

p-value*

HNF4α

24.0

0.0031

ABCC1

56.4

0.0478

Functional knock down of HNF4α was already reported [22]. * A student's t test was done to compare HNF4α siRNA transfection against negative siRNA transfected controls. The results were considered significant when the p value was less than 0.05. Gene expression was determined by real-time quantitaive RT-PCR in triplicates; mitATPase6 served as housekeeping gene. The ΔΔCT-method was used to determine repression of gene expression. Values for HNF4α siRNA transfection represent transcript abundance relative to negative siRNA transfected controls, which were set to 100%.

Discussion

Our study aimed for a better understanding of the role of HNF4α in the regulation of drug transporters. Here we present evidence for expression of HNF4α in the epithelium of the CSF barrier. By applying position weight matrices to genomic sequences of ABC transporters we were able to predict HNF4α binding sites in the promoters of the ABCB4 and ABCC1 gene. The predicted binding sites were then confirmed by EMSA band shift assays. We propose a role for HNF4α in the regulation of drug transporters of the choroid plexus. Notably, HNF4α is a key player in the regulation of genes coding for various metabolic pathways and of xenobiotic metabolism [69, 23, 24]. This protein also promotes expression of an epithelial phenotype [2527]. Specifically, epithelium of the choroid plexus cells is highly differentiated and functions as a blood-CSF barrier. The expression of HNF4α in the epithelium of the choroid plexus and its DNA binding to regulatory sequences of drug transporters is a novel finding. Its expression accounts for approximately a tenth of HNF4α expression found in liver. Furthermore, there is evidence for HNF4α to undergo alternative splicing with isoforms may arising from alternative splicing and/or usage of two different promoters [6]. Specifically, the P1 promoter generates six different isoforms (HNF4α1-α6); but activation of the P2 promoter results in isoforms HNF4α7-α9. P2 promoter-driven HNF4α isoforms are expressed throughout mouse liver development, but disappear after birth, while P1 promoter-driven transcripts are abundantly expressed postnataly [28]. Additionally, P2 isoforms are induced in mouse and human hepatocellular carcinoma [29, 30] and are primarily expressed in human pancreatic islets and exocrine cells [31]. In the case of the choroid plexus it appears that expression of HNF4α is restricted to P1 promoter-driven isoforms. HNF4α protein expression in human and rat choroid plexus could be clearly evidenced by immunohistochemistry. To further qualify tissue preparations of choroid plexus expression of IGF2, TTR and FOXJ1 was investigated; their expression are accepted genetic markers of the choroid plexus [18, 19]. We validated tissue preparations by morphological and genetic markers. Unlike previous studies where expression of HNF4α transcripts could not be evidenced in total RNA extracts of the brain [6], we were able to confirm expression of HNF4α in the choroid plexus of human and rat brain. Most certainly, total brain RNA extracts dilute copy number of HNF4α transcripts to presumable levels below the limit of detection. Here, we evidence binding of HNF4α to regulatory sequences of drug transporters expressed in the choroid plexus and analyzed gene expression of ABC transporters in patients with different causes of death, but the functional significance of the newly identified HNF4α binding sites in activating the ABCB4 and ABCC1 promoters still needs to be established.

In the past attempts to detect HNF4α DNA binding in a choroid plexus papilloma failed [32]. The investigators performed EMSA experiments with nuclear extracts of rat liver, kidney and intestine and of SV40-induced choroid plexus papilloma of transgenic mice, but unfortunately probed for HNF4alpha binding with an oligonucleotide corresponding to the HNF4α binding site in the mouse TTR (transthyretin) promoter. The authors did not employ an antibody in EMSA band shift assays; instead, competition with excess of unlabeled probes was done. Although the authors described a weak binding of HNF4α with nuclear extracts from kidney they considered intestine as well as choroid plexus as deficient for HNF4α binding. There is a need to consider tissue specific DNA binding activity. HNF4α binding at the TTR promoter is much less as compared to the A-site in the HNF1 promoter (not exceeding a tenth, data not shown). As detailed above, HNF4α gene expression in human and rat choroid plexus is approximately one tenth of its expression in the liver (see Figures 1A). It is therefore not surprising that previous investigators [32] failed to detect HNF4α protein in intestine and choroid plexus, even though the authors described weak expression of this protein in kidney. By now, it is well established that HNF4α expression is not restricted to liver, but also functions in kidney and intestine [33, 34]. Here we evidence by immunohistochemical staining HNF4α to be expressed in epithelium of human and rat choroid plexus (see Figures 2).

Notably, the choroid plexus functions as a barrier for drug uptake to the brain. This tissue expresses drug metabolizing enzymes (DMEs) and some transporters [1]. Expression of DMEs in the choroid plexus is part of a defense program to prevent entry of xenobiotics into the brain. The blood-CSF barrier also regulates entry and distribution of various pharmacologically active compounds between the blood and the CSF interface and is basically involved in numerous exchange processes thereby determining the supply of the brain with nutrients and hormones [1]. Indeed, endogenous metabolites, as well as neurotransmitter and metabolites from the brain are cleared via this barrier [19]. In drug therapies efflux transporters of the ABC-family are of pivotal importance in determining therapeutic tissue levels. In the past research focused on their regulation in liver, kidney and intestine [3, 4]. The knowledge on drug transporter in specialized tissues of the brain is incomplete. Specifically, ABCB (MDR) proteins accept a broad range of substrates and may transport large lipophilic, neutral or cationic compounds. This includes a vast number of neuropharmacological drugs such as antiepileptic and antiviral drugs, antidepressants, opiods, antipsychotics and tranquilizer [3540]. ABCB1, a transporter with highest expression in the gastrointestinal tract [4, 41], is expressed at low levels in human choroid plexus, that is much lower than in liver and total brain. Our findings are consistent with results reported previously for rats [42]. Its apical expression in rat, mouse and human choroidal epithelium was shown previously [43]. Furthermore, ABCB4 is highly expressed in the liver, where it is acting as a "flippase" in transporting phospholipids into the bile, but ABCB4 can also bind and transport a subset of ABCB1 substrates with an overlap in substrate specificity [44]. As reported for ABCB1, ABCB4 is expressed at low levels in human choroid plexus, i.e. more than 500 fold lower than in liver. Low ABCB4 expression was also evidenced in choroidal epithelium of the rat [42], but to the best of our knowledge our study is the first report on expression in human choroid plexus. An apical distribution of ABCB1 in neonatal cultured rat choroid plexus cells imply a drug transport from blood into CSF [43]. In endothelial cells of small blood capillaries of the blood-brain barrier, apical located ABCB1 pumps drugs back into the blood stream and therefore limits drug penetration to the brain [2].

Likewise, the ABCC (MRP) proteins are multispecific organic anion transporters and accept glucurono-, glutathione- and sulfo-conjugates. They transport physiological substrate conjugates as well as drug conjugates. Expression of ABCC1-6 mRNA transcripts was reported for rat choroid plexus [42] as was expression of ABCC1 for human choroid plexus [43, 45, 46]. ABCC1, ABCC4 and ABCC5 were expressed in human choroid plexus at least at 10 fold higher than in liver; whereas ABCC2, ABCC3 and ABCC6 were expressed up to 800 fold lower than liver. Similar results were reported for ABCC transporter expression in rat choroid plexus [42]. Notably, ABCC1 is localized at the basolateral membrane of choroid plexus [43, 45, 46], but Gazzin et al [46] described a major difference in the localization of ABCB1 and ABCC1 proteins between the blood-brain and the blood-CSF barrier with strongest expression of ABCC1 at the choroidal epithelium. Indeed, ABCC proteins contribute to the protective role of the choroid plexus and mediate basolateral efflux of conjugates resulting from choroidal drug metabolism into the blood. Although it is known that the choroid plexus is important in regulating the distribution of various pharmacologically active compounds between the blood and the CSF, the characterization of the involved human ABC transporters gives new insights into the function of the CSF barrier.

Furthermore, ABCBs (MDRs) and ABCCs (MRPs) are inducible transporters and are highly responsive to chemotherapeutics, carcinogens, inflammation, heat shock, hypoxia and irradiation [47]. They are regulated by a complex network of transcriptional cascades, such as by multiple ligand activated nuclear receptors like retinoid X receptor (RXR), farnesoid X receptor (FXR), constitutive androstane receptor (CAR) and the xenobiotic receptor pregnane X receptor (PXR) [47, 48]. There is also evidence for the transcription factors AP-1, p53, Egr-1 and WT-1 to participate in their regulation with NF-Y, Sp1 and Sp3 being involved in the constitutive expression [47]. Recently, an upregulation of ABCB1, ABCB4 and ABCC4 transcripts was reported in human embryonic kidney cells that conditionally expressed wild-type HNF4α [33]. An important role of HNF4α in the transcriptional control of drug transporters was reported for human hepatocytes as determined by adenoviral HNF4α-siRNA mediated knockdown [49]. We also employed an siRNA mediated functional knockdown of HNF4α and found ABCC1 gene expression to be massively repressed. There is a need to improve an understanding of the mechanism by which transporters are regulated. This will impact the design of novel CNS therapeutics. Targeting transporters may thus be useful in achieving therapeutic tissue levels of CNS drugs.

Conclusion

We report expression of HNF4α in choroid plexus of the human and rat brain. This factor might regulate expression of some ATP binding cassette transporters. Targeting of HNF4α may impact efficacy of pharmacotherapy of CNS drugs.

Methods

Human and rat tissue

A total of n = 7 human and n = 7 rat tissues were analyzed. Samples of human choroid plexus (n = 3, gene expression analysis) were kindly provided by T. Arendt (Department of Neuroanatomy, Paul-Flechsig-Institute, University of Leipzig, Germany). Paraffin-embedded slices of human choroid plexus for immunohistochemistry (n = 4) were kindly provided by C. Grothe (Institute of Neuroanatomy, Hannover Medical School, Hannover, Germany). Human liver tissue (gene expression analysis) was obtained from patients undergoing hepatic resections and were kindly provided by J. Klempnauer (Department of Visceral and Transplantation Surgery, Hannover Medical School, Hannover, Germany). Patient characteristics are given in Table 5. Control human brain RNA was purchased from BD Biosciences (Heidelberg, Germany).
Table 5

Patient characteristics.

Liver

     

Patient Identification

Sex

Age

Information

Tissue

Application

P29

F

40

Colorectal liver metastasis

Healthy tissue from liver resection

Gene expression analysis, comparison to choroid plexus

P2

F

70

Hepatocellular carcinoma

Healthy tissue from liver resection

Gene expression analysis, comparison to choroid plexus

P3

F

57

Hepatocellular carcinoma

Healthy tissue from liver resection

Gene expression analysis, comparison to choroid plexus

P4

M

67

Hepatocellular carcinoma

Healthy tissue from liver resection

Gene expression analysis, comparison to choroid plexus

Choroid Plexus

     

Patient Identification

Sex

Age

Cause of death

Tissue

Application

44-04

F

63

liver cirrhosis

38 h post mortem

Gene expression analysis

62-04

F

79

ovarial carcinoma

33 h post mortem

Gene expression analysis

100-04

M

74

Acute myocardial infarction

48 h post mortem

Gene expression analysis

H5

M

53

Circulatory failure, liver cirrhosis

Choroid plexus

Paraffin-embedded slices for immunohistochemistry

H40

M

32

Circulatory failure, endocarditis

Choroid plexus

Paraffin-embedded slices for immunohistochemistry

H54

M

59

Respiratory insufficiency, pneunomia

Choroid plexus

Paraffin-embedded slices for immunohistochemistry

H55

M

81

Circulatory failure, generalized artheriosclerosis

Choroid plexus

Paraffin-embedded slices for immunohistochemistry

Samples of rat choroid plexus (n = 3, Sprague Dawley rats, gene expression analysis) were kindly provided by H. Hilbig and K. Spanel-Borowski (Department of Anatomy, University of Leipzig, Germany). Samples of rat liver and brain (Sprague Dawley rats, gene expression analysis) were generated in-house. Paraffin-embedded slices of rat brain (Sprague Dawley rats) containing choroid plexus regions for immunohistochemistry (n = 4) were kindly provided by C. Grothe (Institute of Neuroanatomy, Hannover Medical School, Hannover, Germany).

Quantitative real-time RT-PCR

Analysis of human samples: Three human choroid plexus samples and four human liver samples were analyzed separately and used for calculation of the mean and standard deviation. Analysis of rat samples: Three rat choroid plexus samples, three rat liver and three rat brain samples were analyzed separately and used for calculation of the mean and standard deviation. Total RNA from choroid plexus and liver was isolated using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturers recommendations. Subsequently to RNA isolation, a DNase I digest was performed. 4 μg total RNA from each sample was used for reverse transcription (Omniscript Reverse Transcriptase, Qiagen, Hilden, Germany). Quantitative real-time RT-PCR measurement was done with the Lightcycler (Roche Diagnostics, Mannheim, Germany) with the following conditions: denaturation at 95°C, annealing at different temperatures for 8 sec, extension at 72°C for different times and detection of SYBR-Green I-fluorescence at different temperatures. Detailed primer specific conditions and oligonucleotide sequence information are given in Table 6. Relative quantification was performed using the "Fit Points Method" of the LightCycler3 Data Analysis Software version 3.5.28 (Roche Diagnostics, Mannheim, Germany) by comparing the sample values to a standard curve within the linear range of amplification. This comparison was performed during each LightCycler Run (for genes of interest as well as for the housekeeping gene, i.e. mitATPase6). The standardized sample values for each gene of interest were divided by the standardized values of the housekeeping gene. The slope of external standard curves are given in Table 6, indicating the PCR efficiency for each amplicon.
Table 6

Real-time PCR primer sequences and amplification settings.

Gene

Accession number

Species

Primer sequence

Fragment length

Annealing

Extension

Fluorescence

Slope

HNF4α

NM_000457

human

fwd:CTGCTCGGAGCCACCAAGAGATCCATG

371 bp

60°C

15 sec

88°C

-3.629

   

rev: ATCATCTGCCAGGTGATGCTCTGCA

     

HNF4αP1

NM_178849

human

fwd: GAATGCGACTCTCCAAAACC

339 bp

68°C

14 sec

88°C

-3.058

 

NM_178850

 

rev: GGCACTGGTTCCTCTTGTCT

     
 

NM_000457

       

HNF4αP2

NM_001030003

human

fwd: GGGCTCCAGTGGAGAGTTC

342 bp

68°C

14 sec

88°C

-2.648

   

rev: CATAGCTTGACCTTCGAGTGC

     

FOXJ1

NM_001454

human

fwd: CTACTCGTATGCCACGCTCA

183 bp

60°C

8 sec

86°C

-3.459

   

rev: CGAGGCACTTTGATGAAGC

     

IGF2

NM_000162

human

fwd: GGTGCTTCTCACCTTCTTGG

298 bp

68°C

12 sec

90°C

-2.724

   

rev: GGGGTATCTGGGGAAGTTGT

     

TTR

NM_000371

human

fwd: CAGAAAGGCTGCTGATGACA

261 bp

60°C

11 sec

86°C

-3.438

   

rev: GCCGTGGTGGAATAGGAGTA

     

ABCB1

NM_000927

human

fwd: AAAAAGATCAACTCGTAGGAGTG

161 bp

60°C

7 sec

81°C

-3.331

   

rev: GCACAAAATACACCAACAA

     

ABCB4

NM_000443

human

fwd: CCACAGCGAACTGATGAAGA

301 bp

68°C

13 sec

83°C

-3.826

   

rev: CACGACAAAGTAGGGCCATT

     

ABCC1

NM_004996

human

fwd: AGTCCCCACAGAAGGAGTGG

358 bp

60°C

15 sec

87°C

-3.639

   

rev: TCCCCGACCGTGGAGGATTT

     

ABCC2

NM_000392

human

fwd: CCGTATCAGGTTTGCCAGTT

312 bp

60°C

13 sec

84°C

-3.756

   

rev: CAACAGCCACAATGTTGGTC

     

ABCC3

NM_003786

human

fwd: CTCAATGTGGCAGACATCGG

177 bp

60°C

8 sec

87°C

-3.731

   

rev: GGGAGCTCACAAACGTGTGC

     

ABCC4

NM_005845

human

fwd CTTGGAGAGGAGTTGCAAGG

236 bp

68°C

10 sec

78°C

-4.479

 

NM_001105515

 

rev: GCTGTGTTCAAAGCCACAGA

     

ABCC5

NM_005688

human

fwd: CCTGTTTGGGAAGGAATATGA

203 bp

60°C

9 sec

88°C

-3.446

   

rev: CCTGTTTGGGAAGGAATATGA

     

ABCC6

NM_001171

human

fwd: TTCTCTGTGTCGCTGGTGTC

309 bp

60°C

13 sec

87°C

-2.982

   

rev: GGCACTGTGTATGGTGATGC

     

MitATPase6

NC_001807

human

fwd: CTAAAGGACGAACCTGA

315 bp

55°C

13 sec

83°C

-3.608

   

rev: TGGCCTGCAGTAATGTT

     

HNF4α

NM_022180

rat

fwd: GCCTGCCTCAAAGCCATCAT

274 bp

55°C

11 sec

88°C

-3.697

   

rev: GACCCTCCAAGCAGCATCTC

     

HNF4αP1

D10554, EF193392

rat

fwd: AAATGTGCAGGTGTTGACCA

178 bp

60°C

7 sec

87°C

-3.296

   

rev: CACGCTCCTCCTGAAGAATC

     

HNF4αP2

AF329936

rat

fwd: CTCCAGTGGCGAGTCCTTAT

171 bp

60°C

7 sec

87°C

-2.273

 

EF193390

 

rev: TCACGCTCCTCCTGAAGAAT

     

MitATPase6

NC_001665

rat

fwd: CTAAAGGACGAACCTGA

315 bp

55°C

13 sec

83°C

-3.644

   

rev: TGGCCTGCAGTAATGTT

     

Caco-2 cell culture

Caco-2 cells are a valuable source for HNF4α nuclear protein [21] and were obtained from and cultivated as recommended by DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Braunschweig, Germany) and seeded with a density of 4 × 106 cells per 75 cm2 flask and harvested after 11 days of culture.

Isolation of nuclear extracts

Nuclear extracts from Caco-2 cells were isolated by the modified method of Dignam et al [50]. Eleven days after seeding cells were washed twice with ice-cold PBS, scraped into microcentrifuge tubes and centrifuged for 5 min at 2000 × g, 4°C. Cell pellets were resuspended in lysis buffer (10 mM Tris pH 7.4, 2 mM MgCl2, 140 mM NaCl, 1 mM DTT, 4 mM Pefabloc, 1% Aprotinin, 40 mM β-glycerophosphate, 1 mM sodiumorthovanadate and 0.5% TX100) at 4°C for 10 min (300 μl for 1 × 107 cells), transferred onto one volume of 50% sucrose in lysis buffer and centrifuged at 14000 × g and 4°C for 10 min. Nuclei were resuspended in Dignam C buffer (20 mM Hepes pH 7.9, 25% glycerol, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 1 mM DTT, 4 mM Pefabloc, 1% Aprotinin, 40 mM β-glycerophosphate, 1 mM sodiumorthovanadate, 30 μl for 1 × 107 cells) and gently shaked at 4°C for 30 min. Nuclear debris was removed by centrifugation at 14000 × g at 4°C for 10 min. Protein concentrations were determined according to the method of Smith et al [51]. The extracts were aliquoted and stored at -70°C.

Electrophoretic mobility shift assays

Forward and reverse oligonucleotides (for sequence information see Table 3) were purchased from MWG Biotech (Ebersberg/Muenchen, Germany), annealed and 32P-labeled using 32PγATP and T4-kinase (New England Biolabs, Frankfurt, Germany). 2,5 μg Caco-2 cell nuclear extract and 105 cpm (0.027 ng) radiolabeled probe were incubated in binding buffer consisted of 25 mM HEPES, pH 7.6, 5 mM MgCl2, 34 mM KCl, 2 mM DTT, 2 mM Pefabloc, 2% Aprotinin, 40 ng of poly (dI-dC)/μl and 100 ng of bovine serum albumin/μl for 20 minutes on ice. Free DNA and DNA-protein complexes were resolved on a 6% polyacrylamide gel (acrylamide: bisacrylamide ratio = 37.5:1). Super shift experiments were done with a 1 μg HNF4α specific antibody (sc-6556x, Santa Cruz Biotechnology, Heidelberg, Germany). DNA binding of nuclear extracts to the A-site of the HNF1α-promoter (HNF1pro) served as a positive control.

Bioinformatic searches for HNF4α binding-sites

The transcription start site (TSS, +1) of the NCBI mRNA reference sequence (RefSeq) was aligned using the UCSC Genome Browser http://genome.ucsc.edu/ for promoter annotation of the respective genes. Proximal promoters (up to -7000 bp) of human ABCB1, ABCB4 and ABCC1 to ABCC6 were checked for putative HNF4α binding-sites with the tool MATCH [52], http://www.biobase.de by employing two different weight matrix, i.e. V$HNF4_01, Transfac matrix (generated by Biobase) and V$zemlin13-11045 (self-generated). V$zemlin13-11045 is based on a collection of 33 well known HNF4α sites and was generated using the matrix generation tool of Biobase http://www.biobase.de. At least one of both matrices has to exceed the cut-off of 0.9 for core similarity and 0.9 for matrix similarity (Table 2). Furthermore, proximal promoters (up to -7000 bp) of rat and mouse ABCB4 and ABCC1 were checked for putative HNF4α binding sites (Table 2).

Immunohistochemistry

The sections were deparaffinized, demasked by heating, incubated with 0,6% H2O2 in methanol for 30 min, and subsequently with protein block serum-free reagent (Dako, Glostrup, Denmark) for 10 min. Incubation with polyclonal antibody (Santa Cruz Biotechnology, Heidelberg, Germany) against HNF4α (sc-6556x, 1:400 dilution for rat sections, 1:200 dilution for human sections) was performed for 45 min. The sections were rinsed with Tris-buffered saline, incubated with biotinylated universal secondary antibodies (Dako, Glostrup, Denmark) for 15 min and subsequently with horseradish peroxidase-conjugated streptavidin solution (Dako, Glostrup, Denmark) for 15 min. Labeling was detected using a diaminobenzidine (DAB) chromogen solution (Dako, Glostrup, Denmark) for 5 min. The sections were counterstained with hematoxylin before examination under light microscope. To confirm the specificity of the immunohistochemical localization, antibodies preabsorbed 2 h with a twenty fold excess of antigen for HNF4α (sc-6556P, Santa Cruz Biotechnology, Heidelberg, Germany) were used.

siRNA silencing of HNF4α

Human HNF4α-specific siRNA probes were purchased from Qiagen (Hilden, Germany). Caco-2 cells (1,5 × 105 cells/well in 24-well plate) were transfected in triplicate for 48 h with 25 nM of the siRNA duplex using HiPerFect transfection reagent (Qiagen, Hilden, Germany). Alexa-Fluor488 labeld siRNA (Qiagen, Hilden Germany) was used as negative siRNA and as positive control for transfection efficiency. For transfection efficiency and stable expression of mitATPase6 after transfection see Niehof and Borlak, 2008 [22].

Abbreviations

ABC transporter: 

ATP-binding cassette transporter

CSF: 

cerebrospinal fluid

DME: 

drug metabolizing enzymes

EMSA: 

electrophoretic mobility shift assay

HNF: 

hepatocyte nuclear factor

MDR: 

multidrug resistance gene family (ABCB)

MRP: 

multidrug resistance related proteins gene family (ABCC)

TTR: 

transthyretin.

Declarations

Acknowledgements

We thank S. Marschke, A. Pfanne and A. Schulmeyer for valuable technical assistance, S. Reymann and R. Zemlin for assistance in bioinformatics and advice on design of PCR primers, T. Arendt, U. Gärtner and C. Grothe for providing samples of human choroid plexus and H. Hilbig, K. Spanel-Borowski and C. Grothe for the preparation of rat choroid plexus. This work was supported by a grant of the Lower Saxony Ministry of Culture and Science to J.B.

Authors’ Affiliations

(1)
Fraunhofer Institute for Toxicology and Experimental Medicine, Center of Molecular Medicine and Medical Biotechnology
(2)
Center of Pharmacology and Toxicology, Medical School of Hannover

References

  1. Ghersi-Egea JF, Strazielle N: Brain drug delivery, drug metabolism, and multidrug resistance at the choroid plexus. Microsc Res Tech. 2001, 52: 83-88.View ArticlePubMedGoogle Scholar
  2. Graff CL, Pollack GM: Drug transport at the blood-brain barrier and the choroid plexus. Curr Drug Metab. 2004, 5: 95-108.View ArticlePubMedGoogle Scholar
  3. Schinkel AH, Jonker JW: Mammalian drug efflux transporters of the ATP binding cassette (ABC) family: an overview. Adv Drug Deliv Rev. 2003, 55: 3-29.View ArticlePubMedGoogle Scholar
  4. Glavinas H, Krajcsi P, Cserepes J, Sarkadi B: The role of ABC transporters in drug resistance, metabolism and toxicity. Curr Drug Deliv. 2004, 1: 27-42.View ArticlePubMedGoogle Scholar
  5. Toyoda Y, Hagiya Y, Adachi T, Hoshijima K, Kuo MT, Ishikawa T: MRP class of human ATP binding cassette (ABC) transporters: historical background and new research directions. Xenobiotica. 2008, 38: 833-862.View ArticlePubMedGoogle Scholar
  6. Sladek FM, Seidel SD: Hepatocyte nuclear factor 4alpha. Nuclear Receptors and Disease. Edited by: Burris T, McCabe ERB. 2001, 309-361. Academic Press, LondonGoogle Scholar
  7. Schrem H, Klempnauer J, Borlak J: Liver-enriched transcription factors in liver function and development. Part I: the hepatocyte nuclear factor network and liver-specific gene expression. Pharmacol Rev. 2002, 54: 129-158.View ArticlePubMedGoogle Scholar
  8. Parviz F, Matullo C, Garrison WD, Savatski L, Adamson JW, Ning G, et al: Hepatocyte nuclear factor 4alpha controls the development of a hepatic epithelium and liver morphogenesis. Nat Genet. 2003, 34: 292-296.View ArticlePubMedGoogle Scholar
  9. Jover R, Bort R, Gomez-Lechon MJ, Castell JV: Cytochrome P450 regulation by hepatocyte nuclear factor 4 in human hepatocytes: a study using adenovirus-mediated antisense targeting. Hepatology. 2001, 33: 668-675.View ArticlePubMedGoogle Scholar
  10. Gonzalez FJ: Regulation of hepatocyte nuclear factor 4 alpha-mediated transcription. Drug Metab Pharmacokinet. 2008, 23: 2-7.View ArticlePubMedGoogle Scholar
  11. Barbier O, Girard H, Inoue Y, Duez H, Villeneuve L, Kamiya A, et al: Hepatic expression of the UGT1A9 gene is governed by hepatocyte nuclear factor 4alpha. Mol Pharmacol. 2005, 67: 241-249.View ArticlePubMedGoogle Scholar
  12. Echchgadda I, Song CS, Oh T, Ahmed M, De LCI, Chatterjee B: The xenobiotic-sensing nuclear receptors pregnane X receptor, constitutive androstane receptor, and orphan nuclear receptor hepatocyte nuclear factor 4alpha in the regulation of human steroid-/bile acid-sulfotransferase. Mol Endocrinol. 2007, 21: 2099-2111.View ArticlePubMedGoogle Scholar
  13. Popowski K, Eloranta JJ, Saborowski M, Fried M, Meier PJ, Kullak-Ublick GA: The human organic anion transporter 2 gene is transactivated by hepatocyte nuclear factor-4{alpha} and suppressed by bile acids. Mol Pharmacol. 2005, 67: 1629-1638.View ArticlePubMedGoogle Scholar
  14. Saborowski M, Kullak-Ublick GA, Eloranta JJ: The Human Organic Cation Transporter 1 Gene is Transactivated by Hepatocyte Nuclear Factor-4{alpha}. J Pharmacol Exp Ther. 2006, 317: 778-785.View ArticlePubMedGoogle Scholar
  15. Qadri I, Hu LJ, Iwahashi M, Al Zuabi S, Quattrochi LC, Simon FR: Interaction of hepatocyte nuclear factors in transcriptional regulation of tissue specific hormonal expression of human multidrug resistance-associated protein 2 (abcc2). Toxicol Appl Pharmacol. 2009, 234: 281-292.View ArticlePubMedGoogle Scholar
  16. Douet V, VanWart CM, Heller MB, Reinhard S, Le Saux O: HNF4alpha and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression. Biochim Biophys Acta. 2006, 1759: 426-436.PubMed CentralView ArticlePubMedGoogle Scholar
  17. Sumi K, Tanaka T, Uchida A, Magoori K, Urashima Y, Ohashi R, et al: Cooperative interaction between hepatocyte nuclear factor 4 alpha and GATA transcription factors regulates ATP-binding cassette sterol transporters ABCG5 and ABCG8. Mol Cell Biol. 2007, 27: 4248-4260.PubMed CentralView ArticlePubMedGoogle Scholar
  18. Lim L, Zhou H, Costa RH: The winged helix transcription factor HFH-4 is expressed during choroid plexus epithelial development in the mouse embryo. Proc Natl Acad Sci USA. 1997, 94: 3094-3099.PubMed CentralView ArticlePubMedGoogle Scholar
  19. Strazielle N, Ghersi-Egea JF: Choroid plexus in the central nervous system: biology and physiopathology. J Neuropathol Exp Neurol. 2000, 59: 561-574.PubMedGoogle Scholar
  20. Borlak J, Zwadlo C: Expression of drug-metabolizing enzymes, nuclear transcription factors and ABC transporters in Caco-2 cells. Xenobiotica. 2003, 33: 927-943.View ArticlePubMedGoogle Scholar
  21. Niehof M, Borlak J: RSK4 and PAK5 Are Novel Candidate Genes in Diabetic Rat Kidney and Brain. Mol Pharmacol. 2005, 67: 604-611.View ArticlePubMedGoogle Scholar
  22. Niehof M, Borlak J: HNF4{alpha} and the Ca-Channel TRPC1 Are Novel Disease Candidate Genes in Diabetic Nephropathy. Diabetes. 2008, 57: 1069-1077.View ArticlePubMedGoogle Scholar
  23. Hayhurst GP, Lee YH, Lambert G, Ward JM, Gonzalez FJ: Hepatocyte nuclear factor 4alpha (nuclear receptor 2A1) is essential for maintenance of hepatic gene expression and lipid homeostasis. Mol Cell Biol. 2001, 21: 1393-1403.PubMed CentralView ArticlePubMedGoogle Scholar
  24. Odom DT, Zizlsperger N, Gordon DB, Bell GW, Rinaldi NJ, Murray HL, et al: Control of Pancreas and Liver Gene Expression by HNF Transcription Factors. Science. 2004, 303: 1378-1381.PubMed CentralView ArticlePubMedGoogle Scholar
  25. Chiba H, Gotoh T, Kojima T, Satohisa S, Kikuchi K, Osanai M, et al: Hepatocyte nuclear factor (HNF)-4alpha triggers formation of functional tight junctions and establishment of polarized epithelial morphology in F9 embryonal carcinoma cells. Exp Cell Res. 2003, 286: 288-297.View ArticlePubMedGoogle Scholar
  26. Chiba H, Itoh T, Satohisa S, Sakai N, Noguchi H, Osanai M, et al: Activation of p21(CIP1/WAF1) gene expression and inhibition of cell proliferation by overexpression of hepatocyte nuclear factor-4alpha. Exp Cell Res. 2005, 302: 11-21.View ArticlePubMedGoogle Scholar
  27. Battle MA, Konopka G, Parviz F, Gaggl AL, Yang C, Sladek FM, et al: Hepatocyte nuclear factor 4alpha orchestrates expression of cell adhesion proteins during the epithelial transformation of the developing liver. Proc Natl Acad Sci USA. 2006, 103: 8419-8424.PubMed CentralView ArticlePubMedGoogle Scholar
  28. Torres-Padilla ME, Fougere-Deschatrette C, Weiss MC: Expression of HNF4alpha isoforms in mouse liver development is regulated by sequential promoter usage and constitutive 3' end splicing. Mech Dev. 2001, 109: 183-193.View ArticlePubMedGoogle Scholar
  29. Niehof M, Borlak J: EPS15R, TASP1, and PRPF3 are novel disease candidate genes targeted by HNF4alpha splice variants in hepatocellular carcinomas. Gastroenterology. 2008, 134: 1191-1202.View ArticlePubMedGoogle Scholar
  30. Tanaka T, Jiang S, Hotta H, Takano K, Iwanari H, Sumi K, et al: Dysregulated expression of P1 and P2 promoter-driven hepatocyte nuclear factor-4alpha in the pathogenesis of human cancer. J Pathol. 2006, 208: 662-672.View ArticlePubMedGoogle Scholar
  31. Hansen SK, Parrizas M, Jensen ML, Pruhova S, Ek J, et al: Genetic evidence that HNF-1{alpha}-dependent transcriptional control of HNF-4{alpha} is essential for human pancreatic {beta} cell function. J Clin Invest. 2002, 110: 827-833.PubMed CentralView ArticlePubMedGoogle Scholar
  32. Costa RH, Van Dyke TA, Yan C, Kuo F, Darnell JE: Similarities in transthyretin gene expression and differences in transcription factors: liver and yolk sac compared to choroid plexus. Proc Natl Acad Sci USA. 1990, 87: 6589-6593.PubMed CentralView ArticlePubMedGoogle Scholar
  33. Lucas B, Grigo K, Erdmann S, Lausen J, Klein-Hitpass L, Ryffel GU: HNF4alpha reduces proliferation of kidney cells and affects genes deregulated in renal cell carcinoma. Oncogene. 2005, 24: 6418-6431.PubMedGoogle Scholar
  34. Garrison WD, Battle MA, Yang C, Kaestner KH, Sladek FM, Duncan SA: Hepatocyte nuclear factor 4alpha is essential for embryonic development of the mouse colon. Gastroenterology. 2006, 130: 1207-1220.PubMed CentralView ArticlePubMedGoogle Scholar
  35. Loscher W, Potschka H: Role of multidrug transporters in pharmacoresistance to antiepileptic drugs. J Pharmacol Exp Ther. 2002, 301: 7-14.View ArticlePubMedGoogle Scholar
  36. Potschka H, Fedrowitz M, Loscher W: Multidrug resistance protein MRP2 contributes to blood-brain barrier function and restricts antiepileptic drug activity. J Pharmacol Exp Ther. 2003, 306: 124-131.View ArticlePubMedGoogle Scholar
  37. Dagenais C, Graff CL, Pollack GM: Variable modulation of opioid brain uptake by P-glycoprotein in mice. Biochem Pharmacol. 2004, 67: 269-276.View ArticlePubMedGoogle Scholar
  38. El Ela AA, Hartter S, Schmitt U, Hiemke C, Spahn-Langguth H, Langguth P: Identification of P-glycoprotein substrates and inhibitors among psychoactive compounds–implications for pharmacokinetics of selected substrates. J Pharm Pharmacol. 2004, 56: 967-975.View ArticlePubMedGoogle Scholar
  39. Doran A, Obach RS, Smith BJ, Hosea NA, Becker S, Callegari E, et al: The impact of P-glycoprotein on the disposition of drugs targeted for indications of the central nervous system: evaluation using the MDR1A/1B knockout mouse model. Drug Metab Dispos. 2005, 33: 165-174.View ArticlePubMedGoogle Scholar
  40. Szakacs G, Varadi A, Ozvegy-Laczka C, Sarkadi B: The role of ABC transporters in drug absorption, distribution, metabolism, excretion and toxicity (ADME-Tox). Drug Discov Today. 2008, 13: 379-393.View ArticlePubMedGoogle Scholar
  41. Brady JM, Cherrington NJ, Hartley DP, Buist SC, Li N, Klaassen CD: Tissue distribution and chemical induction of multiple drug resistance genes in rats. Drug Metab Dispos. 2002, 30: 838-844.View ArticlePubMedGoogle Scholar
  42. Choudhuri S, Cherrington NJ, Li N, Klaassen CD: Constitutive expression of various xenobiotic and endobiotic transporter mRNAs in the choroid plexus of rats. Drug Metab Dispos. 2003, 31: 1337-1345.View ArticlePubMedGoogle Scholar
  43. Rao VV, Dahlheimer JL, Bardgett ME, Snyder AZ, Finch RA, Sartorelli AC, et al: Choroid plexus epithelial expression of MDR1 P glycoprotein and multidrug resistance-associated protein contribute to the blood-cerebrospinal-fluid drug-permeability barrier. Proc Natl Acad Sci USA. 1999, 96: 3900-3905.PubMed CentralView ArticlePubMedGoogle Scholar
  44. Smith AJ, van Helvoort A, van Meer G, Szabo K, Welker E, Szakacs G, et al: MDR3 P-glycoprotein, a phosphatidylcholine translocase, transports several cytotoxic drugs and directly interacts with drugs as judged by interference with nucleotide trapping. J Biol Chem. 2000, 275: 23530-23539.View ArticlePubMedGoogle Scholar
  45. Wijnholds J, deLange EC, Scheffer GL, Berg van den DJ, Mol CA, van d V, et al: Multidrug resistance protein 1 protects the choroid plexus epithelium and contributes to the blood-cerebrospinal fluid barrier. J Clin Invest. 2000, 105: 279-285.PubMed CentralView ArticlePubMedGoogle Scholar
  46. Gazzin S, Strazielle N, Schmitt C, Fevre-Montange M, Ostrow JD, Tiribelli C, et al: Differential expression of the multidrug resistance-related proteins ABCb1 and ABCc1 between blood-brain interfaces. J Comp Neurol. 2008, 510: 497-507.View ArticlePubMedGoogle Scholar
  47. Scotto KW: Transcriptional regulation of ABC drug transporters. Oncogene. 2003, 22: 7496-7511.View ArticlePubMedGoogle Scholar
  48. Eloranta JJ, Kullak-Ublick GA: Coordinate transcriptional regulation of bile acid homeostasis and drug metabolism. Arch Biochem Biophys. 2005, 433: 397-412.View ArticlePubMedGoogle Scholar
  49. Kamiyama Y, Matsubara T, Yoshinari K, Nagata K, Kamimura H, Yamazoe Y: Role of human hepatocyte nuclear factor 4alpha in the expression of drug-metabolizing enzymes and transporters in human hepatocytes assessed by use of small interfering RNA. Drug Metab Pharmacokinet. 2007, 22: 287-298.View ArticlePubMedGoogle Scholar
  50. Dignam JD, Lebovitz RM, Roeder RG: Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 1983, 11: 1475-1489.PubMed CentralView ArticlePubMedGoogle Scholar
  51. Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, et al: Measurement of protein using bicinchoninic acid. Anal Biochem. 1985, 150: 76-85.View ArticlePubMedGoogle Scholar
  52. Kel A, Reymann S, Matys V, Nettesheim P, Wingender E, Borlak J: A novel computational approach for the prediction of networked transcription factors of aryl hydrocarbon-receptor-regulated genes. Mol Pharmacol. 2004, 66: 1557-1572.View ArticlePubMedGoogle Scholar

Copyright

© Niehof and Borlak; licensee BioMed Central Ltd. 2009

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement